ID: 995315674

View in Genome Browser
Species Human (GRCh38)
Location 5:110769514-110769536
Sequence GGCTTATGATGTGATGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995315669_995315674 24 Left 995315669 5:110769467-110769489 CCAACAATGGAAACATAGGGCCC No data
Right 995315674 5:110769514-110769536 GGCTTATGATGTGATGCAACTGG No data
995315671_995315674 3 Left 995315671 5:110769488-110769510 CCAGCTGCATTTCATTTTTTTTA No data
Right 995315674 5:110769514-110769536 GGCTTATGATGTGATGCAACTGG No data
995315670_995315674 4 Left 995315670 5:110769487-110769509 CCCAGCTGCATTTCATTTTTTTT No data
Right 995315674 5:110769514-110769536 GGCTTATGATGTGATGCAACTGG No data
995315666_995315674 30 Left 995315666 5:110769461-110769483 CCGCATCCAACAATGGAAACATA No data
Right 995315674 5:110769514-110769536 GGCTTATGATGTGATGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995315674 Original CRISPR GGCTTATGATGTGATGCAAC TGG Intergenic
No off target data available for this crispr