ID: 995322769

View in Genome Browser
Species Human (GRCh38)
Location 5:110855917-110855939
Sequence CACATTTGGTCATATGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995322769_995322773 3 Left 995322769 5:110855917-110855939 CCAAGCTCATATGACCAAATGTG No data
Right 995322773 5:110855943-110855965 TCCAAATCCACTTGGAACAAAGG No data
995322769_995322771 -5 Left 995322769 5:110855917-110855939 CCAAGCTCATATGACCAAATGTG No data
Right 995322771 5:110855935-110855957 ATGTGCCTTCCAAATCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995322769 Original CRISPR CACATTTGGTCATATGAGCT TGG (reversed) Intergenic
No off target data available for this crispr