ID: 995322771

View in Genome Browser
Species Human (GRCh38)
Location 5:110855935-110855957
Sequence ATGTGCCTTCCAAATCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995322768_995322771 5 Left 995322768 5:110855907-110855929 CCTATAATTTCCAAGCTCATATG No data
Right 995322771 5:110855935-110855957 ATGTGCCTTCCAAATCCACTTGG No data
995322769_995322771 -5 Left 995322769 5:110855917-110855939 CCAAGCTCATATGACCAAATGTG No data
Right 995322771 5:110855935-110855957 ATGTGCCTTCCAAATCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995322771 Original CRISPR ATGTGCCTTCCAAATCCACT TGG Intergenic
No off target data available for this crispr