ID: 995322773

View in Genome Browser
Species Human (GRCh38)
Location 5:110855943-110855965
Sequence TCCAAATCCACTTGGAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995322769_995322773 3 Left 995322769 5:110855917-110855939 CCAAGCTCATATGACCAAATGTG No data
Right 995322773 5:110855943-110855965 TCCAAATCCACTTGGAACAAAGG No data
995322768_995322773 13 Left 995322768 5:110855907-110855929 CCTATAATTTCCAAGCTCATATG No data
Right 995322773 5:110855943-110855965 TCCAAATCCACTTGGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995322773 Original CRISPR TCCAAATCCACTTGGAACAA AGG Intergenic
No off target data available for this crispr