ID: 995331933

View in Genome Browser
Species Human (GRCh38)
Location 5:110956351-110956373
Sequence AGATGCCAGCTGCAGTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995331928_995331933 -1 Left 995331928 5:110956329-110956351 CCATCTGGAGTGGCTGCTGCCAA No data
Right 995331933 5:110956351-110956373 AGATGCCAGCTGCAGTGGGGTGG No data
995331927_995331933 0 Left 995331927 5:110956328-110956350 CCCATCTGGAGTGGCTGCTGCCA 0: 8
1: 42
2: 80
3: 123
4: 348
Right 995331933 5:110956351-110956373 AGATGCCAGCTGCAGTGGGGTGG No data
995331922_995331933 26 Left 995331922 5:110956302-110956324 CCTTAAGCTATTGATGGCAGCGG No data
Right 995331933 5:110956351-110956373 AGATGCCAGCTGCAGTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995331933 Original CRISPR AGATGCCAGCTGCAGTGGGG TGG Intergenic
No off target data available for this crispr