ID: 995335964

View in Genome Browser
Species Human (GRCh38)
Location 5:111000167-111000189
Sequence ATGTAACAGCTAATGCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995335964_995335969 25 Left 995335964 5:111000167-111000189 CCAACAAGCATTAGCTGTTACAT No data
Right 995335969 5:111000215-111000237 CTTTACTCAGTGACATCCAGAGG No data
995335964_995335965 -6 Left 995335964 5:111000167-111000189 CCAACAAGCATTAGCTGTTACAT No data
Right 995335965 5:111000184-111000206 TTACATGAATCAGTTCCCTCTGG No data
995335964_995335966 -5 Left 995335964 5:111000167-111000189 CCAACAAGCATTAGCTGTTACAT No data
Right 995335966 5:111000185-111000207 TACATGAATCAGTTCCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995335964 Original CRISPR ATGTAACAGCTAATGCTTGT TGG (reversed) Intergenic
No off target data available for this crispr