ID: 995335966

View in Genome Browser
Species Human (GRCh38)
Location 5:111000185-111000207
Sequence TACATGAATCAGTTCCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995335960_995335966 18 Left 995335960 5:111000144-111000166 CCAATTCTTGCTCCCCATCACTT No data
Right 995335966 5:111000185-111000207 TACATGAATCAGTTCCCTCTGGG No data
995335958_995335966 24 Left 995335958 5:111000138-111000160 CCTGGCCCAATTCTTGCTCCCCA No data
Right 995335966 5:111000185-111000207 TACATGAATCAGTTCCCTCTGGG No data
995335961_995335966 6 Left 995335961 5:111000156-111000178 CCCCATCACTTCCAACAAGCATT No data
Right 995335966 5:111000185-111000207 TACATGAATCAGTTCCCTCTGGG No data
995335963_995335966 4 Left 995335963 5:111000158-111000180 CCATCACTTCCAACAAGCATTAG No data
Right 995335966 5:111000185-111000207 TACATGAATCAGTTCCCTCTGGG No data
995335959_995335966 19 Left 995335959 5:111000143-111000165 CCCAATTCTTGCTCCCCATCACT No data
Right 995335966 5:111000185-111000207 TACATGAATCAGTTCCCTCTGGG No data
995335962_995335966 5 Left 995335962 5:111000157-111000179 CCCATCACTTCCAACAAGCATTA No data
Right 995335966 5:111000185-111000207 TACATGAATCAGTTCCCTCTGGG No data
995335964_995335966 -5 Left 995335964 5:111000167-111000189 CCAACAAGCATTAGCTGTTACAT No data
Right 995335966 5:111000185-111000207 TACATGAATCAGTTCCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995335966 Original CRISPR TACATGAATCAGTTCCCTCT GGG Intergenic
No off target data available for this crispr