ID: 995335969

View in Genome Browser
Species Human (GRCh38)
Location 5:111000215-111000237
Sequence CTTTACTCAGTGACATCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995335968_995335969 -8 Left 995335968 5:111000200-111000222 CCTCTGGGTCTTTTTCTTTACTC No data
Right 995335969 5:111000215-111000237 CTTTACTCAGTGACATCCAGAGG No data
995335964_995335969 25 Left 995335964 5:111000167-111000189 CCAACAAGCATTAGCTGTTACAT No data
Right 995335969 5:111000215-111000237 CTTTACTCAGTGACATCCAGAGG No data
995335967_995335969 -7 Left 995335967 5:111000199-111000221 CCCTCTGGGTCTTTTTCTTTACT No data
Right 995335969 5:111000215-111000237 CTTTACTCAGTGACATCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995335969 Original CRISPR CTTTACTCAGTGACATCCAG AGG Intergenic
No off target data available for this crispr