ID: 995341630

View in Genome Browser
Species Human (GRCh38)
Location 5:111067315-111067337
Sequence TTGTTTTACCCCCACCGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995341627_995341630 16 Left 995341627 5:111067276-111067298 CCTGTTATGTTGTAGAAAAACAG No data
Right 995341630 5:111067315-111067337 TTGTTTTACCCCCACCGGCTGGG No data
995341626_995341630 27 Left 995341626 5:111067265-111067287 CCTATTCATGTCCTGTTATGTTG No data
Right 995341630 5:111067315-111067337 TTGTTTTACCCCCACCGGCTGGG No data
995341625_995341630 28 Left 995341625 5:111067264-111067286 CCCTATTCATGTCCTGTTATGTT No data
Right 995341630 5:111067315-111067337 TTGTTTTACCCCCACCGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995341630 Original CRISPR TTGTTTTACCCCCACCGGCT GGG Intergenic
No off target data available for this crispr