ID: 995342257

View in Genome Browser
Species Human (GRCh38)
Location 5:111073033-111073055
Sequence GCTCCGGGACGCCGCCGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995342247_995342257 10 Left 995342247 5:111073000-111073022 CCTGCTACGTGCAGAACTCCGAG 0: 1
1: 0
2: 0
3: 1
4: 49
Right 995342257 5:111073033-111073055 GCTCCGGGACGCCGCCGCCGGGG 0: 1
1: 0
2: 2
3: 15
4: 193
995342252_995342257 -8 Left 995342252 5:111073018-111073040 CCGAGAGGTGCCTGGGCTCCGGG 0: 1
1: 0
2: 2
3: 32
4: 262
Right 995342257 5:111073033-111073055 GCTCCGGGACGCCGCCGCCGGGG 0: 1
1: 0
2: 2
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995342257 Original CRISPR GCTCCGGGACGCCGCCGCCG GGG Intronic
900014172 1:137389-137411 GCCCCGGGAGGCCGCCGTGGGGG + Intergenic
900044035 1:492591-492613 GCCCCGGGAGGCCGCCGTGGGGG + Intergenic
900065445 1:727497-727519 GCCCCGGGAGGCCGCCGTGGGGG + Intergenic
900180130 1:1307657-1307679 GGGCCGGGCCGCGGCCGCCGGGG - Intronic
900244923 1:1632343-1632365 GCTCCAGGCCGGCACCGCCGGGG - Exonic
900269174 1:1778424-1778446 GCTCGGCGGCGCCGGCGCCGGGG - Intronic
901279962 1:8026294-8026316 GCACCGGACCGCCGTCGCCGCGG + Exonic
902323580 1:15684340-15684362 GCTCCGGAGCGCGGCCGGCGGGG - Exonic
905449291 1:38046653-38046675 GCACCCGGACGCCGCGGCGGCGG - Exonic
905755888 1:40508830-40508852 GCTCCCGGACGCTCCCGGCGAGG - Exonic
906678591 1:47710028-47710050 TCTCCAGCACCCCGCCGCCGAGG + Intergenic
907213420 1:52842630-52842652 CCTCCGACACGCCGCTGCCGGGG - Intronic
908534632 1:65066694-65066716 TCTCCGGACCGCCGCCGCCGCGG + Intergenic
912315092 1:108661110-108661132 GCTGCGTGACGCTACCGCCGCGG + Intronic
912401536 1:109397694-109397716 GCTGCGGGCGGCCGCAGCCGGGG - Exonic
915326915 1:155085478-155085500 GCTCCGGGGCGGGGCCGGCGCGG + Intronic
916750913 1:167722107-167722129 GCTCAGGGACGCGGCGGCGGCGG + Exonic
918423577 1:184387075-184387097 GTTCCGTGCCGCGGCCGCCGCGG + Exonic
919403224 1:197146347-197146369 GCTGCGGGGCCCCGCGGCCGAGG - Exonic
923171474 1:231421573-231421595 GCGCCGGGACAACGCCTCCGGGG - Exonic
1064022815 10:11823414-11823436 GCTCCGGGTCGCTGGCGGCGTGG + Exonic
1065533629 10:26697746-26697768 GCTCCTGGAAGCCGGCGGCGCGG + Exonic
1066732617 10:38449140-38449162 GCCCCGGGAGGCCGCCGTGGGGG - Intergenic
1067051959 10:43026738-43026760 GGTCCGGGACGCCGCGGGCAGGG + Intergenic
1067694337 10:48524157-48524179 GCCCCGGGGCGGCGCGGCCGAGG + Intronic
1068910468 10:62374213-62374235 GTTCCGGAACGCCGCGGCCCAGG - Exonic
1070145791 10:73772515-73772537 GCTCTGGGACGCCGCGGCCAGGG + Exonic
1073048931 10:100655781-100655803 GCTCCGGCGCGCAGCCACCGCGG + Intergenic
1073059431 10:100724549-100724571 GAGCCTGGTCGCCGCCGCCGCGG - Intergenic
1073061366 10:100735676-100735698 GCCCCAGGACGCGGCGGCCGCGG + Intronic
1074130329 10:110567994-110568016 TCTCCGCGACCCCGCAGCCGGGG - Intronic
1074618488 10:115093482-115093504 GGTCCGGGACGCCGCGGCTGTGG + Intronic
1075562711 10:123480153-123480175 GCTCCGGGACGCGGTCTCCGTGG - Intergenic
1081488360 11:43548250-43548272 GGACAGGGACGCGGCCGCCGAGG - Intergenic
1081969189 11:47186420-47186442 GCTCCGGGAGGCCGCGGCGCGGG - Intronic
1085052675 11:73387855-73387877 GCTCAGGGCCGCCGCGGCTGAGG - Intronic
1085346040 11:75768762-75768784 GCTCCGGGACGCCAGCGCCGCGG + Exonic
1085719870 11:78903323-78903345 GCTCCTGGGCGCCGCCGGCAGGG + Exonic
1089432715 11:118436697-118436719 GCTTCCCGCCGCCGCCGCCGCGG - Exonic
1089700250 11:120240228-120240250 GTTCCCGGCCGCCGCCGCCGCGG - Intronic
1092502648 12:9064536-9064558 GCTCTCGCCCGCCGCCGCCGCGG + Intergenic
1092743021 12:11648948-11648970 GCTCGGGGATGCGGCGGCCGCGG - Intergenic
1098255432 12:68611078-68611100 GCCCCGCGCGGCCGCCGCCGCGG - Intronic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1100869543 12:98895325-98895347 ACTCCGGGAGGCCGCCGGGGCGG + Intronic
1101144788 12:101830845-101830867 GCTCCCGGAAGCGGCGGCCGCGG - Exonic
1101466940 12:104958407-104958429 GCTCCGGGTCGCCGCCCCGCGGG - Intronic
1101865180 12:108515295-108515317 GCTCCGGGCCGCCGGCTCCCGGG - Exonic
1102254057 12:111406026-111406048 CCCCCGGGCCGCCGCCGCCGGGG - Exonic
1102256430 12:111418198-111418220 GCCCCGCGGGGCCGCCGCCGGGG - Exonic
1102853961 12:116277514-116277536 CCTCGGAGCCGCCGCCGCCGCGG + Intergenic
1104929197 12:132329357-132329379 GCGCCGGGCCACGGCCGCCGGGG + Intergenic
1107779096 13:43879482-43879504 GCTGCGGGATGCCGACTCCGCGG + Exonic
1113200999 13:107867343-107867365 GCCCGCGGGCGCCGCCGCCGGGG + Intergenic
1114658909 14:24332608-24332630 CATGCGGGACGCCGCCGTCGCGG - Exonic
1115664803 14:35534666-35534688 CCCCGGGGGCGCCGCCGCCGTGG + Exonic
1121617008 14:95319973-95319995 GGTCGGGGCCGCCCCCGCCGCGG + Intergenic
1122436806 14:101706267-101706289 CCTCCGGGGCGGCGCCGCCACGG - Intergenic
1122648014 14:103207687-103207709 GCACCGCGAAGCCGTCGCCGTGG - Intergenic
1122941987 14:104985647-104985669 GCCCCGGGCCGCCTCCGCTGCGG - Intergenic
1124619335 15:31265087-31265109 GCTTCAGGACGCCGCCTCTGTGG + Intergenic
1125051174 15:35299488-35299510 GCTCCGCGCTGCCGCCACCGCGG - Intronic
1128309657 15:66622256-66622278 ACTCGGAGACGCCGCGGCCGCGG - Intronic
1129162194 15:73753087-73753109 GCGCCGGGTCGCCGCCGGTGGGG + Intergenic
1129871597 15:78945017-78945039 GCTCTGGGCCGCCACCTCCGCGG - Exonic
1130517171 15:84634158-84634180 GCGCCGGGACAGCGCCTCCGGGG + Intergenic
1130613434 15:85381165-85381187 TCCCCGGGTCGGCGCCGCCGGGG + Intronic
1132055674 15:98648984-98649006 CCTCAGCGCCGCCGCCGCCGCGG - Exonic
1132099875 15:99015436-99015458 GCGCCGGGACGCCTCGGCTGTGG + Intergenic
1132512827 16:352701-352723 ACTTCCGGACGCCGCCGGCGGGG - Intergenic
1133156347 16:3879796-3879818 GCCCCGGGCCCCCGCCGCCCCGG + Intronic
1133332965 16:4987786-4987808 CCTCCTGGACCCCGCCGCCCTGG - Intronic
1137618232 16:49858947-49858969 GCTCTGGGGTGCCCCCGCCGCGG + Intergenic
1142156351 16:88534359-88534381 GCTCCGGGGAGCGGGCGCCGCGG - Exonic
1142449879 16:90168416-90168438 GCCCCGGGAGGCCGCCGTGGGGG - Intergenic
1142457207 17:63430-63452 GCCCCGGGAGGCCGCCGTGGGGG + Intergenic
1144816711 17:18039969-18039991 GCTCCTCGACCCCGCAGCCGCGG + Intronic
1146398592 17:32487098-32487120 GCGCCGCGGCCCCGCCGCCGCGG - Exonic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1148079573 17:44960277-44960299 GCACCTGGACGCCGGCGACGAGG - Exonic
1149678701 17:58488480-58488502 GCTGGGGCACGCGGCCGCCGAGG - Intergenic
1149849490 17:60026605-60026627 GCTCCGGGAGGGCCCCGCAGCGG + Intergenic
1149860678 17:60119919-60119941 GCTCCGGGAGGGCCCCGCAGCGG - Intergenic
1151414129 17:73950615-73950637 GCTCCGGGTCCCCGCCTCCACGG - Intergenic
1152222212 17:79075065-79075087 CTTCCCGGCCGCCGCCGCCGCGG - Exonic
1152722072 17:81928118-81928140 GCGTCAGGACGGCGCCGCCGGGG + Intergenic
1153997431 18:10454518-10454540 CCCCCGGGCAGCCGCCGCCGGGG - Intergenic
1154148401 18:11885729-11885751 GCTCGGGGACTCGGCCCCCGTGG + Exonic
1156275839 18:35581876-35581898 GCTCCGGGACTGCCCAGCCGCGG - Intronic
1158718242 18:59899783-59899805 GCCGCGGGTCGGCGCCGCCGCGG + Intergenic
1160647566 19:200535-200557 GCCCCGGGAGGCCGCCGTGGGGG + Intergenic
1160991603 19:1862583-1862605 GAACCGCGTCGCCGCCGCCGGGG - Intronic
1161069505 19:2253160-2253182 ACTCCGGGACTCCGCTGCCGCGG + Intronic
1161222087 19:3122475-3122497 GCCCCGGGAGGCGGCCCCCGGGG - Exonic
1161485818 19:4535135-4535157 GCTCCCGGACGCCGCCCTCAGGG + Intronic
1161703246 19:5805938-5805960 GCTCGCCGCCGCCGCCGCCGGGG + Intergenic
1162036551 19:7943295-7943317 TCCACGGGACGCCGCCGCCCCGG + Intronic
1163631398 19:18419623-18419645 GCTCCACGCCGCCGCCGCCGGGG - Exonic
1163635075 19:18433843-18433865 CCTCCGGCCCGACGCCGCCGCGG - Intronic
1165459601 19:35936686-35936708 CAGCCGGGACGCCGCCGCCCCGG + Intronic
1166797977 19:45439673-45439695 GCGTCGGGACGCGTCCGCCGGGG - Intronic
1168255075 19:55160715-55160737 GCTCCGCGACGTGGCCGCCTGGG - Exonic
1168343812 19:55641059-55641081 GCTCCGGGCCGGCGGCGCCGGGG - Intronic
1168538545 19:57191787-57191809 GCTCGGGGCCGCCGCCTCCTCGG - Exonic
1168705345 19:58467413-58467435 GCCCCGGGACGCTGCTGGCGGGG + Exonic
926018533 2:9474819-9474841 CCTCCGGGACGCCGCGGGCCCGG - Intronic
926101711 2:10122436-10122458 GGTCGGGGGCGCCGCCGCCCAGG - Exonic
927572832 2:24175097-24175119 GCTCCAGGACGCGGCCTCGGGGG + Exonic
927809397 2:26173188-26173210 GCCCCGGGACGGCGGCCCCGGGG + Exonic
927861412 2:26562449-26562471 GCTCCGGGAGGTGGCCGCCAGGG + Intergenic
938301112 2:130213664-130213686 GGCCCGGGGCGCTGCCGCCGCGG + Intergenic
941905729 2:170715463-170715485 GGAGCGGGACGCCGCCGCCGAGG - Exonic
942346277 2:175005515-175005537 GCTCCGGGCGGCCGCCTCCAGGG - Intergenic
945314819 2:208360327-208360349 GCTCGGGGAGGCCGCCGCTCCGG - Intronic
948199627 2:236120285-236120307 GCTGCGGGCCACCGCCGACGAGG + Exonic
948467432 2:238159061-238159083 CCTGCTGGCCGCCGCCGCCGCGG + Exonic
948824653 2:240568411-240568433 GCTCCGCTCGGCCGCCGCCGGGG - Intronic
1170999041 20:21395964-21395986 GGCCCTGGACGCGGCCGCCGGGG - Exonic
1172015428 20:31870257-31870279 GCGCCGGGCCGCGGCGGCCGGGG + Intronic
1175847474 20:62066118-62066140 GCTCAGGGGCGCGGGCGCCGGGG + Intergenic
1176547444 21:8207969-8207991 GCCCCGGGGCCCCGCCACCGGGG - Intergenic
1176555349 21:8252178-8252200 GCCCCGGGGCCCCGCCACCGGGG - Intergenic
1176566395 21:8391016-8391038 GCCCCGGGGCCCCGCCACCGGGG - Intergenic
1176574271 21:8435203-8435225 GCCCCGGGGCCCCGCCACCGGGG - Intergenic
1178513837 21:33229905-33229927 GCGCCGCGCCGCCGCCGGCGCGG - Intronic
1179472498 21:41620844-41620866 GCTCAGGGTGGCCGCAGCCGGGG - Intergenic
1180193410 21:46180115-46180137 GACCGTGGACGCCGCCGCCGTGG - Intronic
1180557863 22:16592136-16592158 GCTCCGGGAGGCCTACGCCACGG - Exonic
1180871703 22:19150292-19150314 CGGCCGGGGCGCCGCCGCCGCGG + Intergenic
1183370100 22:37427331-37427353 CCTCCGGGAAGCGGCGGCCGCGG + Exonic
1184243402 22:43223252-43223274 GCTCCAGGAAGCCTCCGCCCTGG - Intronic
1185055368 22:48576146-48576168 GCGCCGGGGGGCGGCCGCCGCGG - Intronic
1185088002 22:48751033-48751055 CATCCGGGACGCCGACGCCACGG - Intronic
1185255108 22:49827496-49827518 CCTTCGGGGCGCCGCGGCCGCGG + Intronic
1203252317 22_KI270733v1_random:124254-124276 GCCCCGGGGCCCCGCCACCGGGG - Intergenic
1203260374 22_KI270733v1_random:169340-169362 GCCCCGGGGCCCCGCCACCGGGG - Intergenic
953694382 3:45146289-45146311 ACTCCGGGACGCCTCGGCCTCGG + Exonic
953947573 3:47163351-47163373 GGTCCGAGGCGCCGCCGTCGCGG + Intronic
954076878 3:48188079-48188101 GTTCAGGGACGCGGCTGCCGCGG + Exonic
959539836 3:107525151-107525173 GCGCGGGGACGTCGGCGCCGGGG - Intronic
964482803 3:157159640-157159662 GCCCCGGCACGCCCCGGCCGCGG + Intronic
968701120 4:2058816-2058838 GCTCCGGGCCGGGGCAGCCGCGG + Intergenic
969252744 4:5980317-5980339 GCTCCGGGACTCAGAGGCCGAGG - Exonic
970456350 4:16226993-16227015 GAGCCGGGCCCCCGCCGCCGCGG - Intronic
971230843 4:24799484-24799506 CCTGCGGGACGCCCCCGCGGAGG - Exonic
973137316 4:46724426-46724448 GCGCCCTGCCGCCGCCGCCGCGG - Intergenic
976600712 4:86935286-86935308 GGCCCCCGACGCCGCCGCCGCGG + Intronic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
985629847 5:1008732-1008754 GCTGCGGGCAGCGGCCGCCGGGG + Intergenic
986831139 5:11579867-11579889 GCTGCTGGACGCCGCAGCCGGGG - Intronic
992400146 5:76403919-76403941 GCTCCGGGTCGCCGCCGGCTTGG + Intronic
992611209 5:78510048-78510070 GCTCCGGGGAGCCCCCGCCCGGG + Exonic
993903816 5:93602437-93602459 GCTCGAGGACGCCGGCGCCCAGG - Intergenic
995342257 5:111073033-111073055 GCTCCGGGACGCCGCCGCCGGGG + Intronic
996329354 5:122312059-122312081 GCTTCGGGCCGCGGCCGCCCAGG + Exonic
999322653 5:150624859-150624881 GCTCCCGGGCGCCGCCGCCTCGG - Intronic
1000220184 5:159208220-159208242 CAACCGGGCCGCCGCCGCCGCGG + Intronic
1002729808 5:181326338-181326360 GCCCCGGGAGGCCGCCGTGGGGG - Intergenic
1002901877 6:1416518-1416540 GCACCGGGGCGCCGCCTGCGGGG + Intergenic
1002927209 6:1611446-1611468 GCGCGAGGACGCGGCCGCCGAGG - Exonic
1003624079 6:7727017-7727039 GCTGCGGGCCCCCGCCGCTGCGG + Exonic
1003625210 6:7735113-7735135 GCTCCGGGGCTCTGCCTCCGAGG - Intronic
1006301022 6:33193490-33193512 ATCCCTGGACGCCGCCGCCGAGG - Intergenic
1006665086 6:35688265-35688287 GCGCCGGGACGCCGCGGGCGCGG - Intronic
1007154064 6:39725209-39725231 CCTCCGGGGCGCCGGCGCGGCGG - Intronic
1013117468 6:107114441-107114463 GCTCCCGGCCGCCGCCGCCGCGG + Intronic
1014098243 6:117482796-117482818 GCGCCAGTGCGCCGCCGCCGCGG - Exonic
1016820613 6:148342959-148342981 GCTCGGTGACGCCGCGGGCGGGG + Exonic
1018986848 6:168644224-168644246 GCTTCGGGACCCCTCCGCCCTGG + Intronic
1019139128 6:169932555-169932577 GCTCCGGGGCGCCGCTTGCGGGG + Intergenic
1019343753 7:519994-520016 GGGCCCGGGCGCCGCCGCCGCGG + Intronic
1019485484 7:1287457-1287479 ACTCAGGGACGCCGCCTCCCAGG - Intergenic
1019735165 7:2646861-2646883 GCTCCTGGGGGCCGCCGCCCTGG + Exonic
1020010879 7:4805350-4805372 GCTCCTTGACTCCCCCGCCGAGG + Intronic
1020238524 7:6374696-6374718 GCGCCCTGCCGCCGCCGCCGCGG + Exonic
1022113790 7:27246284-27246306 GCCCCGGGCTGCCGCCGCCTCGG + Exonic
1022698006 7:32728684-32728706 GGGCCGGGGGGCCGCCGCCGCGG + Intergenic
1024074475 7:45811591-45811613 GCCCCGGGAGGCCGCCGTGGGGG - Intergenic
1024074806 7:45812949-45812971 GCCCCGGGAGGCCGCCGTGGGGG - Intergenic
1024579781 7:50792804-50792826 GCTCCTGGGGGCCGCCGCCTGGG - Intronic
1028762336 7:94509913-94509935 GGTCGGGGGCGCCGCGGCCGCGG + Exonic
1031895950 7:127347901-127347923 GCTCTCGGGCGGCGCCGCCGCGG + Intronic
1032051524 7:128653459-128653481 GCCCCGGGAGGCCGCCGTGGGGG - Intergenic
1034934696 7:155191272-155191294 GCTCCCGGACCCGGCCCCCGTGG - Intergenic
1035023067 7:155809978-155810000 TCTCCGCGCCCCCGCCGCCGGGG + Intronic
1035751963 8:2002515-2002537 GCCCCGGGGCGCCTTCGCCGTGG + Exonic
1037807533 8:22066906-22066928 GCCCCGGGCCGGGGCCGCCGAGG + Intronic
1038002424 8:23403439-23403461 GCTCCCGGGCGCAGCCCCCGGGG + Intronic
1038540418 8:28386077-28386099 GCTCCGGGCTGCAGCGGCCGCGG + Intronic
1044574646 8:93754849-93754871 GCTCAGCGAAGCCGCCGCAGAGG + Exonic
1049237274 8:141518612-141518634 GCTCCGGGAAGGCGGCGGCGGGG - Exonic
1049543418 8:143218633-143218655 GCTCCAGGACGCCTCAGCTGGGG + Intergenic
1049844194 8:144792199-144792221 TTTCCGGGACCCCGCCCCCGAGG + Intronic
1049936374 9:504790-504812 GCTCCGGGACAACCTCGCCGCGG - Intronic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1057773164 9:97984467-97984489 GGCCCCGGGCGCCGCCGCCGCGG - Intronic
1059471117 9:114505377-114505399 GCCCCGGGATGCAGCCGCCCGGG + Intronic
1060555225 9:124504546-124504568 GCTCCGGGAAGCCGAGCCCGAGG + Intronic
1061196658 9:129110563-129110585 AGTCCGCGCCGCCGCCGCCGCGG + Exonic
1061832269 9:133303708-133303730 GCTCCGGGAAGCCGTCTCTGGGG - Intergenic
1062332300 9:136050053-136050075 GCAGCCGGCCGCCGCCGCCGCGG - Exonic
1062754220 9:138278850-138278872 GCCCCGGGAGGCCGCCGTGGGGG - Intergenic
1203773929 EBV:62490-62512 GCGCCGGTACGCGGCCGCCAGGG + Intergenic
1203468722 Un_GL000220v1:107405-107427 GCCCCGGGGCCCCGCCACCGGGG - Intergenic
1203476543 Un_GL000220v1:151377-151399 GCCCCGGGGCCCCGCCACCGGGG - Intergenic
1203577780 Un_KI270745v1:21607-21629 GCCCCGGGAGGCCGCCGTGGGGG - Intergenic
1185761170 X:2691006-2691028 GCTTCGGGTCGGCGCCGCCCTGG + Intergenic
1187826143 X:23334632-23334654 TCTCCGGGAGGGCGCGGCCGCGG + Exonic
1190008063 X:46758967-46758989 CTACCGGGGCGCCGCCGCCGCGG - Exonic
1192317370 X:70063346-70063368 GCTCGAGGCCGGCGCCGCCGGGG + Exonic
1199772639 X:150984152-150984174 GCCCCGGGCCGCGGGCGCCGGGG - Intronic