ID: 995348130

View in Genome Browser
Species Human (GRCh38)
Location 5:111144115-111144137
Sequence GTGGTAGCCCAGTAATCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995348121_995348130 18 Left 995348121 5:111144074-111144096 CCGCCCACCGATTCTCCCTCGGG No data
Right 995348130 5:111144115-111144137 GTGGTAGCCCAGTAATCTGAAGG No data
995348119_995348130 19 Left 995348119 5:111144073-111144095 CCCGCCCACCGATTCTCCCTCGG No data
Right 995348130 5:111144115-111144137 GTGGTAGCCCAGTAATCTGAAGG No data
995348118_995348130 28 Left 995348118 5:111144064-111144086 CCAAGTTCTCCCGCCCACCGATT No data
Right 995348130 5:111144115-111144137 GTGGTAGCCCAGTAATCTGAAGG No data
995348124_995348130 14 Left 995348124 5:111144078-111144100 CCACCGATTCTCCCTCGGGAGAC No data
Right 995348130 5:111144115-111144137 GTGGTAGCCCAGTAATCTGAAGG No data
995348125_995348130 11 Left 995348125 5:111144081-111144103 CCGATTCTCCCTCGGGAGACTTG No data
Right 995348130 5:111144115-111144137 GTGGTAGCCCAGTAATCTGAAGG No data
995348127_995348130 2 Left 995348127 5:111144090-111144112 CCTCGGGAGACTTGTGTGAGAGG No data
Right 995348130 5:111144115-111144137 GTGGTAGCCCAGTAATCTGAAGG No data
995348126_995348130 3 Left 995348126 5:111144089-111144111 CCCTCGGGAGACTTGTGTGAGAG No data
Right 995348130 5:111144115-111144137 GTGGTAGCCCAGTAATCTGAAGG No data
995348123_995348130 15 Left 995348123 5:111144077-111144099 CCCACCGATTCTCCCTCGGGAGA No data
Right 995348130 5:111144115-111144137 GTGGTAGCCCAGTAATCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995348130 Original CRISPR GTGGTAGCCCAGTAATCTGA AGG Intergenic
No off target data available for this crispr