ID: 995349781

View in Genome Browser
Species Human (GRCh38)
Location 5:111161809-111161831
Sequence CAAGATCTGAATGGTTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995349776_995349781 17 Left 995349776 5:111161769-111161791 CCCCCATACTTCTGTTTTCATGA No data
Right 995349781 5:111161809-111161831 CAAGATCTGAATGGTTTTAAAGG No data
995349779_995349781 14 Left 995349779 5:111161772-111161794 CCATACTTCTGTTTTCATGATAG No data
Right 995349781 5:111161809-111161831 CAAGATCTGAATGGTTTTAAAGG No data
995349777_995349781 16 Left 995349777 5:111161770-111161792 CCCCATACTTCTGTTTTCATGAT No data
Right 995349781 5:111161809-111161831 CAAGATCTGAATGGTTTTAAAGG No data
995349778_995349781 15 Left 995349778 5:111161771-111161793 CCCATACTTCTGTTTTCATGATA No data
Right 995349781 5:111161809-111161831 CAAGATCTGAATGGTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995349781 Original CRISPR CAAGATCTGAATGGTTTTAA AGG Intergenic
No off target data available for this crispr