ID: 995351005

View in Genome Browser
Species Human (GRCh38)
Location 5:111175552-111175574
Sequence TCATCTCTTTAGAATGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995351001_995351005 -6 Left 995351001 5:111175535-111175557 CCCAGGACCTATATATTTCATCT No data
Right 995351005 5:111175552-111175574 TCATCTCTTTAGAATGTGTAGGG No data
995350997_995351005 8 Left 995350997 5:111175521-111175543 CCTTCCCTACCTATCCCAGGACC No data
Right 995351005 5:111175552-111175574 TCATCTCTTTAGAATGTGTAGGG No data
995350998_995351005 4 Left 995350998 5:111175525-111175547 CCCTACCTATCCCAGGACCTATA No data
Right 995351005 5:111175552-111175574 TCATCTCTTTAGAATGTGTAGGG No data
995351002_995351005 -7 Left 995351002 5:111175536-111175558 CCAGGACCTATATATTTCATCTC No data
Right 995351005 5:111175552-111175574 TCATCTCTTTAGAATGTGTAGGG No data
995350999_995351005 3 Left 995350999 5:111175526-111175548 CCTACCTATCCCAGGACCTATAT No data
Right 995351005 5:111175552-111175574 TCATCTCTTTAGAATGTGTAGGG No data
995351000_995351005 -1 Left 995351000 5:111175530-111175552 CCTATCCCAGGACCTATATATTT No data
Right 995351005 5:111175552-111175574 TCATCTCTTTAGAATGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995351005 Original CRISPR TCATCTCTTTAGAATGTGTA GGG Intergenic
No off target data available for this crispr