ID: 995353218

View in Genome Browser
Species Human (GRCh38)
Location 5:111206373-111206395
Sequence CATCATAGACAGATATTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995353215_995353218 -1 Left 995353215 5:111206351-111206373 CCAAACTGGAGTCCAGTTTGTCC No data
Right 995353218 5:111206373-111206395 CATCATAGACAGATATTGTTAGG No data
995353213_995353218 17 Left 995353213 5:111206333-111206355 CCAAAATCAACGGAATGGCCAAA No data
Right 995353218 5:111206373-111206395 CATCATAGACAGATATTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995353218 Original CRISPR CATCATAGACAGATATTGTT AGG Intergenic
No off target data available for this crispr