ID: 995353404

View in Genome Browser
Species Human (GRCh38)
Location 5:111209369-111209391
Sequence CATACTCTCTGATAAGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995353398_995353404 29 Left 995353398 5:111209317-111209339 CCAAAAACAGTTTTGATTTTGTT No data
Right 995353404 5:111209369-111209391 CATACTCTCTGATAAGCCAGAGG No data
995353403_995353404 -10 Left 995353403 5:111209356-111209378 CCTGAGGAAGATGCATACTCTCT No data
Right 995353404 5:111209369-111209391 CATACTCTCTGATAAGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995353404 Original CRISPR CATACTCTCTGATAAGCCAG AGG Intergenic
No off target data available for this crispr