ID: 995354065

View in Genome Browser
Species Human (GRCh38)
Location 5:111217581-111217603
Sequence GTAGTTCTCCAGGGCTAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995354065_995354069 30 Left 995354065 5:111217581-111217603 CCACTTTAGCCCTGGAGAACTAC No data
Right 995354069 5:111217634-111217656 TTTCCTTGAATATCATATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995354065 Original CRISPR GTAGTTCTCCAGGGCTAAAG TGG (reversed) Intergenic
No off target data available for this crispr