ID: 995357269

View in Genome Browser
Species Human (GRCh38)
Location 5:111253306-111253328
Sequence TGTGCTGATGGTGCTTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995357266_995357269 0 Left 995357266 5:111253283-111253305 CCCATGGAGAAGACTCAGAGCTG 0: 1
1: 0
2: 0
3: 20
4: 217
Right 995357269 5:111253306-111253328 TGTGCTGATGGTGCTTTTCTAGG 0: 1
1: 0
2: 2
3: 35
4: 270
995357264_995357269 20 Left 995357264 5:111253263-111253285 CCTTCGGGTTCTGGCAGCTGCCC 0: 1
1: 0
2: 0
3: 14
4: 153
Right 995357269 5:111253306-111253328 TGTGCTGATGGTGCTTTTCTAGG 0: 1
1: 0
2: 2
3: 35
4: 270
995357267_995357269 -1 Left 995357267 5:111253284-111253306 CCATGGAGAAGACTCAGAGCTGT 0: 1
1: 0
2: 9
3: 81
4: 524
Right 995357269 5:111253306-111253328 TGTGCTGATGGTGCTTTTCTAGG 0: 1
1: 0
2: 2
3: 35
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995357269 Original CRISPR TGTGCTGATGGTGCTTTTCT AGG Intronic
900939470 1:5788904-5788926 AGTGCTGATGAGACTTTTCTGGG - Intergenic
903542413 1:24104413-24104435 TGTGTTGATGTTTCTTTTCTGGG + Intronic
905832969 1:41089080-41089102 AGTGCTGATGCTGCTGGTCTGGG + Intronic
910232578 1:85001414-85001436 TCTGCTGAGGGTGCTCTTCCTGG - Intronic
911213752 1:95169254-95169276 CATGCTGATGCTGCTTATCTGGG + Intronic
912038975 1:105361174-105361196 TGTGCTCATAGTGCTTCTTTTGG + Intergenic
913362410 1:117996620-117996642 TTTGCTGATGATTCTTTTCAAGG + Exonic
914807532 1:151002506-151002528 TGTCCTGAGGGTGCTCATCTGGG + Exonic
915273894 1:154774960-154774982 TGTGCTGAGGGTGTATTTCCAGG - Intronic
915431137 1:155868002-155868024 TGTGCTGGTGGTGTGTGTCTCGG + Exonic
915487494 1:156232000-156232022 TAGGCTGATGGTGCTGGTCTGGG - Intronic
917265344 1:173215197-173215219 TCTGGTGAGGGTTCTTTTCTTGG - Intergenic
918996097 1:191762190-191762212 TTTGTTGTTGGTGTTTTTCTTGG + Intergenic
920388447 1:205583972-205583994 TGTGCTGATGCTGCTGTCCAAGG + Exonic
921118099 1:212113524-212113546 GGTGCTGATGCTGCTGGTCTAGG + Intergenic
924672308 1:246141544-246141566 TATGCTGCTGTTGCTTTTGTTGG - Intronic
1063547326 10:6993892-6993914 TGGGATGATGGTGCTTATCTGGG - Intergenic
1065361226 10:24890847-24890869 TTTGCTGATGGTGCCTTTTGAGG - Intronic
1066356974 10:34694426-34694448 TGTTCTGATGCTATTTTTCTTGG - Intronic
1067311780 10:45120637-45120659 GATGCTGATGTTGCTGTTCTGGG + Intergenic
1068138484 10:52974707-52974729 GGTGCTTTTGGTGCTCTTCTGGG + Intergenic
1068222326 10:54059684-54059706 GATGCTGATGCTGCTTTTCCAGG + Intronic
1068457233 10:57271784-57271806 TGTACTGATTGTGCTGTACTGGG + Intergenic
1068594861 10:58891821-58891843 TTTGTTGCGGGTGCTTTTCTTGG + Intergenic
1071265749 10:83963321-83963343 TCTGGTGAAGGCGCTTTTCTGGG - Intergenic
1071328003 10:84535588-84535610 AGTTCTGATAGTGCTTTTATGGG + Intergenic
1073123963 10:101138593-101138615 TGTGCTGATGGTGTATGTGTTGG + Intergenic
1073644957 10:105292412-105292434 TGTGCTGATGGTGTTTTAATTGG - Intergenic
1074370291 10:112895201-112895223 TAAGGTGATGGTGGTTTTCTAGG - Intergenic
1076611686 10:131730013-131730035 TGTGCTCATGGTGCAGTTATGGG + Intergenic
1076705507 10:132299178-132299200 TGTGCTGCTGGGTCTTGTCTTGG - Intronic
1076705531 10:132299337-132299359 TGTGCTGCTGGGTCTTGTCTTGG - Intronic
1076747631 10:132522387-132522409 TCTGCTGAGGGTGCGTTGCTGGG + Intergenic
1079111766 11:17609299-17609321 TGTGCTGATCTTGCTTCTCTGGG - Intronic
1080544868 11:33306865-33306887 TGTGCTGCTGTTGCTTTTCAGGG + Intronic
1081238102 11:40670607-40670629 TTTGCTGCTGGTGGTTTTATGGG - Intronic
1082245550 11:49917968-49917990 TGTGCTGCTGGTGGTGTCCTGGG - Intergenic
1083186507 11:61020873-61020895 GTTGCTGTTGGTGCTTTTCCTGG - Intergenic
1083306004 11:61762356-61762378 TGAGCTCATGGTGCTGTTTTCGG + Intronic
1084143446 11:67250051-67250073 AGCACTGATGTTGCTTTTCTGGG + Intronic
1085087159 11:73676796-73676818 TCTGCTGAGGGTTCTTTTGTTGG + Exonic
1085765521 11:79278568-79278590 TCTGCTGATGCTGCTTTGATGGG - Intronic
1086279092 11:85164917-85164939 GGTGCTGATGCTGCTGGTCTGGG - Intronic
1086597976 11:88597223-88597245 TCTGATGATGTTGCTTTTCTTGG + Exonic
1086974770 11:93119169-93119191 TGTGTTGATGCTGGTTTCCTAGG - Intergenic
1087824982 11:102754892-102754914 TTTGCTGCTGGTGCTGCTCTGGG - Intergenic
1088905448 11:114151932-114151954 TATGCTGCTGTTGCTGTTCTAGG + Intronic
1091778188 12:3198304-3198326 TGTGCTGATGGTGCTGGTGGTGG - Intronic
1091866334 12:3840406-3840428 AGTGCTAATGGGGCTTTTATTGG - Intronic
1092403474 12:8197830-8197852 TATGCTGCTGCTGCTTCTCTGGG + Intergenic
1092771084 12:11897357-11897379 AGTGCTGATGGTGCTGGTCCAGG + Intergenic
1093149415 12:15603619-15603641 GGTGCTGACATTGCTTTTCTGGG - Intergenic
1095309247 12:40678045-40678067 TTTGTTGATGGTGCTTTTTTTGG + Intergenic
1099070261 12:78037246-78037268 TCTGCTGATGCTGCTTGGCTTGG - Intronic
1100366148 12:93922591-93922613 TGTGCAGATGGCACTTTTCCTGG - Intergenic
1100537948 12:95528770-95528792 TGTGTTCTTGGTGCTTTCCTAGG - Intronic
1101109404 12:101471355-101471377 TGTGCTGATGGCATTTTCCTGGG + Intergenic
1101492006 12:105218378-105218400 TGTCCTCATGGGGCTTTTCAGGG + Intronic
1102977625 12:117217930-117217952 GGTGCTGATGCTGCTGTTTTGGG + Intronic
1103629770 12:122250794-122250816 AGTACTCATGGTGCTTTTGTCGG - Intronic
1103819643 12:123687251-123687273 ACAGCTCATGGTGCTTTTCTAGG + Intronic
1104184623 12:126418458-126418480 ACTGCTATTGGTGCTTTTCTGGG + Intergenic
1104265128 12:127225111-127225133 TTTGCTTATGGTGATTGTCTGGG - Intergenic
1107078508 13:36348880-36348902 TGTGCTCATGTGGCTATTCTGGG - Intronic
1107817660 13:44258556-44258578 TGTGGTGAGGGTGCGTTTCCAGG - Intergenic
1109923704 13:69106016-69106038 TCTTATGAAGGTGCTTTTCTAGG - Intergenic
1110869541 13:80434393-80434415 TTTGTTTAAGGTGCTTTTCTTGG - Intergenic
1111584614 13:90268450-90268472 TGTGCTAATGGGGTTTTTATAGG + Intergenic
1111962122 13:94823292-94823314 TGTGCTTATGGTGCTGGTCTGGG - Intergenic
1112814442 13:103255123-103255145 TGTGTTGATGATGCCTTACTGGG - Intergenic
1114038851 14:18657276-18657298 TCTGCTGAGGGTTCTTTTGTTGG + Intergenic
1115956988 14:38792336-38792358 TGTGCTTAGGGTGCTCTCCTTGG - Intergenic
1117080472 14:52146806-52146828 TGAGATGATGGGGATTTTCTAGG + Intergenic
1117089279 14:52233996-52234018 TGTGCTGATATGCCTTTTCTTGG - Intergenic
1117331319 14:54715000-54715022 TGTGTTGATGTTGCTTCTTTGGG + Intronic
1117524348 14:56582336-56582358 GGTGCTTGTGGTGCTTTTCGGGG + Intronic
1120489638 14:85161184-85161206 TGTGCTGGTGGTGCTTTCCAGGG - Intergenic
1122175091 14:99911390-99911412 TGTGCTAATGATGGTTTTCTTGG + Intronic
1122540931 14:102497306-102497328 CGTCCTGCTGGTGCTTTTGTGGG + Intronic
1123171236 14:106374370-106374392 TGTGCTGAAGGAGCTGGTCTGGG + Intergenic
1123194926 14:106606829-106606851 TGTGCTGAAGATGCTGGTCTGGG + Intergenic
1123222970 14:106873464-106873486 TGTGTTGAAGGAGCTGTTCTGGG + Intergenic
1123476551 15:20595489-20595511 TTTCCAGATGCTGCTTTTCTGGG + Intergenic
1123641460 15:22404875-22404897 TTTCCAGATGCTGCTTTTCTGGG - Intergenic
1124158674 15:27250197-27250219 GGAGCTGATGGTGCTCCTCTAGG - Intronic
1124430457 15:29603286-29603308 GCTGCTGATGCTGCTGTTCTGGG - Intergenic
1124437098 15:29659504-29659526 AGTGGTGATAGTGGTTTTCTGGG - Intergenic
1127601786 15:60544904-60544926 TGTCCTGATGGTCCTTGACTTGG - Intronic
1127935978 15:63638536-63638558 TGAGATGATTGTGGTTTTCTAGG - Exonic
1128460029 15:67859962-67859984 TGTGCTGATGGTGTCTCTCAGGG - Intergenic
1130350152 15:83084352-83084374 TGTGCTCATGATTTTTTTCTAGG + Intergenic
1130393766 15:83483306-83483328 TGTGCTGATGGAAATGTTCTTGG + Intronic
1131481647 15:92787427-92787449 GATGCTGATGGTGCTGGTCTGGG - Intronic
1132292122 15:100711137-100711159 TGTGGTGATGGTGCTTGTGGAGG - Intergenic
1133068584 16:3229515-3229537 TCTGAGGCTGGTGCTTTTCTTGG - Intronic
1133132493 16:3685999-3686021 GATGGTGATGGTGCCTTTCTCGG + Exonic
1135183603 16:20295879-20295901 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1137519267 16:49178270-49178292 TGAGCCCATGGTGCTTCTCTGGG + Intergenic
1137581194 16:49634559-49634581 TTTGCTGAGGGTGTTTTTCCTGG - Intronic
1138384020 16:56623861-56623883 TGTGTTGATGATGATTTTGTGGG - Intergenic
1139025202 16:62807969-62807991 TGTCCTGTTGGTGCTTCTTTGGG + Intergenic
1141890427 16:86923079-86923101 TCTGGTGATGGTGCTCTTCCCGG - Intergenic
1141987503 16:87589401-87589423 GGTGCTGATGCTGCTGGTCTGGG - Intergenic
1142771863 17:2103929-2103951 TGTGTTGATGGTGATTCTCCTGG - Intronic
1144581551 17:16462197-16462219 TGTGCGGTGGGTGCCTTTCTGGG - Intronic
1144704893 17:17361934-17361956 TCTGCTCAGGGTGCTCTTCTGGG + Intergenic
1144718381 17:17450454-17450476 TGCACTGATGGTGCTGTCCTGGG + Intergenic
1144795045 17:17885517-17885539 TCTGGTGATTGTGCTTTTCTTGG - Intronic
1144918700 17:18745746-18745768 AGTGCTGATGTTGCTGGTCTGGG + Intronic
1145831359 17:27919133-27919155 TGTGCTAATTGTGGTTTTCCTGG + Intergenic
1147043825 17:37738290-37738312 TGTGGTGTTTGTGCTTTTGTTGG - Intronic
1147500867 17:40962351-40962373 TAAGCTGATGCTGCATTTCTAGG - Intronic
1147526334 17:41227187-41227209 TGTGAGGATGGTGGTTCTCTTGG - Exonic
1147527365 17:41238539-41238561 TGTGAGGATGGTGGTTCTCTTGG - Exonic
1147528484 17:41250193-41250215 TGTGAGGATGGTGGTTCTCTTGG - Exonic
1147605149 17:41770213-41770235 TGTGATGTTGGTGGTTCTCTGGG - Intronic
1148002669 17:44398861-44398883 TGTGCCAATGTTGCTGTTCTGGG + Exonic
1148188245 17:45660184-45660206 GGTGCTGATGCTGCTGGTCTGGG + Intergenic
1148884689 17:50763720-50763742 TTAGCTGAGGGTTCTTTTCTTGG + Intergenic
1151051390 17:70983070-70983092 TATGCTAATGGTGCTTTTGTTGG - Intergenic
1151184752 17:72355592-72355614 TCTGGTGAGGGTCCTTTTCTGGG + Intergenic
1154006310 18:10530510-10530532 AGTGCTGATGGTGCTGGTCCAGG + Intronic
1156299013 18:35818823-35818845 TGAACTGATGGTGTTTTTATTGG - Intergenic
1156939123 18:42743620-42743642 TGTATTGATGATGCTTTTCATGG - Exonic
1156940043 18:42756037-42756059 AGTGATCATGGTGCTTTTGTGGG + Intronic
1159601804 18:70435133-70435155 TTTGCTGATGCTACTTCTCTGGG + Intergenic
1159605933 18:70474860-70474882 TGTGCTGCTGGTGGTTTTAGAGG + Intergenic
1161440746 19:4290380-4290402 TTTGGGGATGGTGCCTTTCTGGG + Intronic
1163019911 19:14476416-14476438 TGTGCTGGTGGGGCCTGTCTGGG - Intergenic
1163473755 19:17512828-17512850 TGAGCTGATGATGGTTTTGTGGG + Intronic
1163816056 19:19465180-19465202 TGTCCTGGGGATGCTTTTCTGGG + Intronic
1163838488 19:19591263-19591285 GGTGCTCATGGGGCTTTCCTGGG - Intronic
1163984371 19:20931180-20931202 AGTGCTGATGTTGCTTCCCTTGG - Intronic
1167244572 19:48365472-48365494 TGTGCTGAGGGGGCTTCTGTGGG - Intronic
1168422172 19:56211594-56211616 GGTGCTGATGCTGCTGGTCTTGG + Intergenic
1168665892 19:58204423-58204445 TGTGTGGACGGTGCTATTCTGGG + Intronic
925026830 2:615741-615763 AGTTCTGATGGTACTTTTCTTGG - Intergenic
928100667 2:28435706-28435728 GGTGCTGGTGGAGCTTTTCTGGG + Intergenic
928205757 2:29282149-29282171 TTTGCTGCTGGTGCTTGTCTGGG + Intronic
928904941 2:36357681-36357703 TGGGCTGATGATGCTGTTCCGGG + Intronic
928924955 2:36568087-36568109 GGTGCTTATGGTGCTTAACTGGG + Intronic
929285604 2:40131829-40131851 TGTGCTGATGAGGATTATCTTGG + Intronic
929942381 2:46344411-46344433 TGTGTTGATGATGCTTTTGTTGG + Intronic
931197347 2:60064925-60064947 TGAACTGAGGGTGCTTTTCCAGG - Intergenic
932896300 2:75643903-75643925 TGTGCTGATGTTGCTAGTCAAGG + Intergenic
934701839 2:96448338-96448360 TGTGGAGTTGGTGCTTTCCTGGG + Intergenic
935717699 2:105953321-105953343 TCTGCTGAGGGTGCTCTTCCTGG - Intergenic
936646687 2:114380032-114380054 TGTGCTGCTGTTGCAATTCTTGG + Intergenic
937126660 2:119478922-119478944 TTGTCTGATGCTGCTTTTCTTGG - Intronic
938184068 2:129212348-129212370 TGTGCAAATGGGGCTTTTCTGGG + Intergenic
938443902 2:131362002-131362024 TCTGCTGAGGGTTCTTTTGTTGG + Intergenic
938604268 2:132876047-132876069 TGCACTGATGGTTATTTTCTGGG - Intronic
938769502 2:134489082-134489104 TGTGAGGATGGTGTTTCTCTAGG - Intronic
939032957 2:137098558-137098580 TGTTCAAATGATGCTTTTCTAGG - Intronic
940170473 2:150824709-150824731 TGTGCTGATGCTACTAGTCTGGG - Intergenic
940514470 2:154663791-154663813 TATGCTGATGCTGCTGGTCTGGG - Intergenic
940985899 2:160052071-160052093 TGTGGAGATGGTGATTATCTAGG - Intronic
945315319 2:208364500-208364522 AGTGCTGTTGGAGCTCTTCTTGG + Intronic
946484483 2:220088138-220088160 TCTGGTGAGGGTTCTTTTCTTGG - Intergenic
946634078 2:221705339-221705361 TGTGTGGATGGTGTCTTTCTTGG - Intergenic
947274143 2:228371942-228371964 GGTGCTGAGGGAGCTTTTCTAGG - Intergenic
947532773 2:230923356-230923378 TGTGCCAATGCTGCTTTTTTAGG - Intronic
948137787 2:235649705-235649727 TGTGCTGATGCTGCTTGTCTGGG + Intronic
948256981 2:236575655-236575677 TGTGCTGTGTGTGCGTTTCTGGG + Intronic
948573185 2:238930266-238930288 TGTCCTGATGGTGCTTCACTAGG + Intergenic
948740230 2:240041729-240041751 TGAGCTGAAGAAGCTTTTCTTGG + Intergenic
1173549603 20:43923517-43923539 GGTGCTGATGGTGCCAGTCTGGG + Intronic
1173825299 20:46044302-46044324 TGTACTGAAGGAGCTCTTCTTGG + Intronic
1175473895 20:59255098-59255120 TGTGTTGATGGTGGCTTTCTTGG - Exonic
1176416162 21:6476001-6476023 TGTGCAGATGGGTCTGTTCTTGG - Intergenic
1177139914 21:17346818-17346840 TGTGCTTTTGCTTCTTTTCTGGG - Intergenic
1177217627 21:18150510-18150532 TCTGCTGATGGGCCTTTTCCGGG + Intronic
1177678970 21:24339159-24339181 TGTGCAGATGGGGCTGTTGTTGG - Intergenic
1178523893 21:33308731-33308753 GGTGCTGATGCTGCTGGTCTAGG - Intergenic
1179691662 21:43084335-43084357 TGTGCAGATGGGTCTGTTCTTGG - Intergenic
1181083283 22:20427737-20427759 TGTGCCCATGTTTCTTTTCTGGG - Intronic
1181622756 22:24102287-24102309 TGTGTTGATAGTGCCTTTCTTGG + Intronic
1182162970 22:28141858-28141880 TGTGTTGATGTGGCTTTTCTTGG - Intronic
1184074663 22:42168674-42168696 TGTGCTGAGGCTGCCTTTCGCGG + Exonic
1184524023 22:45010892-45010914 TTTGCTGATGGTGCTTGCTTGGG - Intergenic
949328338 3:2892311-2892333 AATGCTGATGCTGCTTGTCTGGG + Intronic
949720969 3:6989888-6989910 TGTGCTAATGGTTCTTTTCCTGG + Intronic
951578247 3:24135089-24135111 TGTGCTGATGAAGCTGCTCTGGG + Intronic
951605282 3:24426536-24426558 TCTGCTGAAGGTGGGTTTCTAGG - Intronic
951844618 3:27072270-27072292 GGTGCTGATGCTGCTTGTCTGGG - Intergenic
952213737 3:31254843-31254865 TCTGCTGAGGGTGCTTTTCCTGG + Intergenic
953137129 3:40190698-40190720 GGTGCTGATGCTGCTGGTCTGGG - Intronic
954408902 3:50360915-50360937 GGTGCTGATGCTTTTTTTCTGGG + Intronic
954985836 3:54790913-54790935 TGTGGAGATGGTGCTTTTCAGGG - Intronic
956065563 3:65393828-65393850 TGTGCTGCTGCTTCTTTTGTAGG + Intronic
956601387 3:71026508-71026530 TGTGCTGTTGGGGCCTTTGTGGG - Intronic
956716214 3:72082413-72082435 GATGCTGATGCTGCTTGTCTAGG - Intergenic
958686882 3:97409551-97409573 TCTGCTGATGCTGATTTTCTAGG + Intronic
959345889 3:105193970-105193992 TGTGCTAATTTTGCTCTTCTTGG - Intergenic
960238038 3:115307242-115307264 TCTGGTGGTGGTGCTTTTCCTGG - Intergenic
960305032 3:116050584-116050606 TGGTTTGCTGGTGCTTTTCTAGG - Intronic
960489253 3:118292261-118292283 TCTGCTGATTGTGGTTTACTGGG + Intergenic
961708770 3:128810519-128810541 TCTGGTGAGGGTGCTTTTCTGGG + Intronic
963382456 3:144548899-144548921 AGTGCTGATGATGCCTTTTTTGG + Intergenic
965930732 3:174039777-174039799 TGTGTTTATGGTGCCTTTGTAGG + Intronic
967418802 3:189251191-189251213 AGTTCTGATAGTGCTCTTCTCGG - Intronic
969448505 4:7259471-7259493 TGTGCTGAGGGCGCTCTTCCTGG + Intronic
969762586 4:9199962-9199984 TATGCTGCTGCTGCTTCTCTGGG - Intergenic
972578296 4:40372320-40372342 TGTGCTGATGCTGCTGGTCCGGG - Intergenic
974059435 4:57017767-57017789 TGTGCTTAAGGCACTTTTCTGGG + Intronic
976775464 4:88701094-88701116 TGTTGTGATGGTGTTTCTCTTGG + Intronic
977039110 4:91992539-91992561 TGTGCTGAAAGTTATTTTCTTGG - Intergenic
977358260 4:95973587-95973609 TCTGCTCCTGGTGCTTTTGTTGG - Intergenic
977692474 4:99929790-99929812 TGTGCTGATATTACTTTGCTAGG - Intronic
981472312 4:145150642-145150664 AGTGCTGATGGGGCTTTTATTGG + Exonic
981490830 4:145337558-145337580 TGTGGAGTTGCTGCTTTTCTTGG + Intergenic
981895685 4:149796200-149796222 TGTGGTGATGCTGCCTGTCTTGG - Intergenic
982402402 4:154982795-154982817 TGTGTTGATGCTGCTTTTCTTGG + Intergenic
984064755 4:175034131-175034153 TTTGTTTAAGGTGCTTTTCTTGG - Intergenic
986249523 5:6043875-6043897 TGTGCTGTTAATGCTTATCTGGG + Intergenic
989704740 5:44315493-44315515 AGTGGTAGTGGTGCTTTTCTGGG + Intronic
990306425 5:54497999-54498021 TTTGTTTATGGTGCTTTTCCTGG + Intergenic
994115881 5:96060900-96060922 TCTGGTGAAGGTGCTCTTCTTGG + Intergenic
995133877 5:108659828-108659850 GGTGCTGATGCTGCTTTTGCTGG - Intergenic
995357269 5:111253306-111253328 TGTGCTGATGGTGCTTTTCTAGG + Intronic
996684172 5:126262508-126262530 TGTGTTCATGGTGCCTTTGTTGG - Intergenic
997615221 5:135241573-135241595 TGTGCTGTGTGAGCTTTTCTGGG + Intronic
999530742 5:152460927-152460949 TGTTCTGATGCTGCTTTAGTTGG + Intergenic
1000370527 5:160531495-160531517 GATGCTGATGTTGCTCTTCTTGG + Intergenic
1002584264 5:180231969-180231991 TGTGCTTATGGCATTTTTCTTGG + Intergenic
1002763120 6:217268-217290 TGTGCTGATGGCGCCTGCCTGGG + Intergenic
1003500255 6:6697240-6697262 GGTGCTGATGCTGCTGGTCTGGG - Intergenic
1003731358 6:8828147-8828169 GATGCTGATGGTGCTTATATGGG + Intergenic
1005490067 6:26339808-26339830 TCTGATGGTGGTGGTTTTCTTGG - Intergenic
1006226098 6:32537744-32537766 TGTGCTTATTTTGCTTTTCTAGG - Intergenic
1008507752 6:52247208-52247230 TGTGCTGAGGGAGCTGATCTGGG + Intergenic
1009644031 6:66373675-66373697 TGGGCAGATGGAGGTTTTCTTGG + Intergenic
1010555852 6:77278208-77278230 ATTGCTGATGTTGTTTTTCTTGG - Intergenic
1011118268 6:83920716-83920738 TCTGCTGATTGTAATTTTCTGGG + Intronic
1011811895 6:91141775-91141797 TGTGCTGAGTGTGCCCTTCTGGG + Intergenic
1012771812 6:103447334-103447356 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1013742697 6:113306555-113306577 GGTGCTGATGCTGCTAATCTGGG + Intergenic
1014080212 6:117277742-117277764 TATGCTGCTGCTGCTTTTCTAGG - Intergenic
1015206757 6:130649411-130649433 TGTGCCAAAGGTACTTTTCTGGG - Intergenic
1015344784 6:132143485-132143507 AGTGCTGCTGCTGCTGTTCTAGG - Intergenic
1015661243 6:135575989-135576011 TGTGCACATGGGGCTTTTGTGGG + Intergenic
1016746505 6:147586186-147586208 AGTGCTGCTGCTGCTTCTCTTGG + Intronic
1017275984 6:152569094-152569116 GGTGCTGATGCTGCTGCTCTGGG - Intronic
1017936087 6:159006536-159006558 TATGCTGCTGCTTCTTTTCTTGG - Intergenic
1018079305 6:160245277-160245299 TTTCCTGATCGTGTTTTTCTTGG - Intronic
1018201320 6:161398376-161398398 GATGCTGATGGTGCTAGTCTGGG - Intronic
1018215161 6:161519210-161519232 TGTGTGGATGGTGCTGTTCAAGG + Intronic
1018937693 6:168284329-168284351 GGTGCTGAAGGTGCCTGTCTGGG - Intergenic
1019191894 6:170256121-170256143 TCAGCTGAGGGTGCATTTCTGGG + Intergenic
1023174772 7:37425208-37425230 TCTGGTGAGGGTGCTCTTCTGGG + Intronic
1027142479 7:75668674-75668696 TGAGCTGATGGTGCTATCATTGG - Intronic
1027932516 7:84555445-84555467 TGCCATGCTGGTGCTTTTCTCGG + Intergenic
1028387490 7:90273732-90273754 TCTGATGAGGGTGCTCTTCTGGG + Intronic
1029160590 7:98548908-98548930 TGTGCTTATGGTTTTATTCTGGG + Intergenic
1030655047 7:112158181-112158203 TGTGCTGATGCTTCTGGTCTTGG + Intronic
1031041368 7:116841772-116841794 GGTGCTGATGCTGCTTGTCAGGG - Intronic
1031356186 7:120789924-120789946 TGTGCAGATGGTCCTCTACTTGG - Intronic
1031458453 7:122013550-122013572 TTTGCTGATGGTGATTTACCAGG - Exonic
1031758805 7:125683339-125683361 TTTGCTGAATGTGCTATTCTAGG - Intergenic
1031977810 7:128104851-128104873 GATGCTGATGCTGCTGTTCTGGG - Intergenic
1033171079 7:139085070-139085092 AGTGCTGATGGTGCTGGTCCGGG - Intronic
1033780228 7:144659813-144659835 TGGGCAGTTGGAGCTTTTCTGGG - Intronic
1033965617 7:146971597-146971619 TCTGCTGAAGAGGCTTTTCTAGG + Intronic
1035392817 7:158516788-158516810 ATTGCTCTTGGTGCTTTTCTTGG + Intronic
1036272673 8:7321697-7321719 TATGCTGCTGCTGCTTCTCTGGG - Intergenic
1036348675 8:7988647-7988669 TATGCTGCTGCTGCTTCTCTGGG + Intergenic
1036495706 8:9268277-9268299 TGTGGAGATGGTGCTTTACTGGG + Intergenic
1036675145 8:10825340-10825362 TCTGTTGATGGTTCTTTCCTGGG - Intronic
1036843942 8:12149119-12149141 TATGCTGCTGCTGCTTCTCTGGG + Intergenic
1036865311 8:12391440-12391462 TATGCTGCTGCTGCTTCTCTGGG + Intergenic
1037100736 8:15042292-15042314 TGTGCTGATGCCTCTCTTCTGGG + Intronic
1038626665 8:29200604-29200626 TGTGTTGATGGTTAATTTCTTGG - Intronic
1038815714 8:30902002-30902024 TGTGCTGATGCTGCTGATCTAGG - Intergenic
1039602576 8:38853043-38853065 TGTGGTGTTGGTACTTTTCCTGG + Intergenic
1039877670 8:41601399-41601421 TGTGCTGCTCGAGATTTTCTTGG - Intronic
1042094079 8:65192654-65192676 TGAGCTGATGGTGCTTTCTGAGG - Intergenic
1042186781 8:66143950-66143972 TGGTATGATGGTGCTTTGCTTGG + Intronic
1045679067 8:104639590-104639612 GATGCTGATGCTGCTATTCTGGG - Intronic
1046092171 8:109516331-109516353 TCTGCTGAGGGTTCTTTGCTCGG + Intronic
1047064738 8:121268376-121268398 GATGCTGATGCTGCTTGTCTGGG - Intergenic
1048115510 8:131517427-131517449 TGTGTTGATTGAGTTTTTCTGGG + Intergenic
1048431096 8:134371724-134371746 TGTGGTGAGGGTTCTCTTCTAGG - Intergenic
1048658949 8:136574468-136574490 TTTGCTGTATGTGCTTTTCTTGG - Intergenic
1049491949 8:142909814-142909836 TGTGCTTCTGATGCTTTTCTGGG + Intronic
1049598477 8:143495962-143495984 TGTGTTCATAGTTCTTTTCTAGG - Intronic
1049952548 9:659470-659492 AATGCTGATGCTGCTGTTCTGGG + Intronic
1052925401 9:34011793-34011815 TGTAGTGATGGTACTTTTCTTGG - Intronic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056464490 9:86840258-86840280 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1056565668 9:87770748-87770770 TGTGCTCATTGTCCTTTGCTTGG - Intergenic
1056633021 9:88308939-88308961 TTTTCAGATGGTGCTTTTTTAGG + Intergenic
1059227204 9:112682988-112683010 TGTTCTGATGTAGCTTTTATTGG + Intergenic
1059522928 9:114960903-114960925 AATGCTGATGCTGCTTATCTAGG + Intergenic
1060782790 9:126425349-126425371 AGTGTTTATGGTGGTTTTCTTGG + Intronic
1061591302 9:131599489-131599511 TGTGCTCATGGTACCCTTCTGGG - Intronic
1062544860 9:137057188-137057210 TGTGCTGGACGTGCTGTTCTGGG + Intergenic
1187830802 X:23379389-23379411 TATGCTGCTGCTGCTGTTCTAGG + Intronic
1188118301 X:26273230-26273252 TGCACTGATGCTTCTTTTCTAGG + Intergenic
1188143995 X:26587066-26587088 TCTGCTGATGCTCCTTCTCTGGG + Intergenic
1189124203 X:38428702-38428724 TCTGCTGATGCTGCTGTTCCAGG + Intronic
1189756028 X:44272020-44272042 TGTGCTGTGGGTCCTTCTCTTGG - Intronic
1191795211 X:65014419-65014441 TATGCTGACTGTGCTGTTCTTGG - Intronic
1192098023 X:68233829-68233851 TGTGTATATGGTGCTTTTGTTGG - Intronic
1192108071 X:68335458-68335480 GATGCTGATGCTGTTTTTCTAGG + Intronic
1192205219 X:69091325-69091347 TGTGCTCATGGCGCTTTTTCTGG - Intergenic
1195234813 X:102886968-102886990 TGTGGTGGTGGTGTTTTTTTTGG + Intergenic
1198464597 X:136893570-136893592 GGTGTTGATGCTGCTATTCTGGG - Intergenic
1198699922 X:139385397-139385419 TCTGATGAGGGTGCCTTTCTTGG - Intergenic