ID: 995357641

View in Genome Browser
Species Human (GRCh38)
Location 5:111257835-111257857
Sequence TGTCCTTCGCAGGACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 10, 2: 29, 3: 44, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995357638_995357641 -2 Left 995357638 5:111257814-111257836 CCATAAAAAGGAACAAGATCATG 0: 288
1: 888
2: 2743
3: 4422
4: 7932
Right 995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG 0: 1
1: 10
2: 29
3: 44
4: 202
995357636_995357641 16 Left 995357636 5:111257796-111257818 CCAAGGAATACTATGCAGCCATA 0: 120
1: 25394
2: 13984
3: 8114
4: 5300
Right 995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG 0: 1
1: 10
2: 29
3: 44
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995357641 Original CRISPR TGTCCTTCGCAGGACATGGA TGG Intronic
900758387 1:4454023-4454045 TGTCCTGGGCAAGAGATGGAGGG - Intergenic
902086951 1:13870280-13870302 TGTCCTTTGCAGGACACAGGAGG - Intergenic
903377569 1:22876387-22876409 TTTCCTTCTCAGGGCATGCAGGG - Intronic
906020290 1:42622240-42622262 TGTCATTTGCAATACATGGATGG - Intronic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
909794511 1:79716732-79716754 TGTTCTTGGCAGGCCCTGGAAGG + Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
913715061 1:121525204-121525226 TGTCCTTTGTAGGAAATAGATGG + Intergenic
914994258 1:152527576-152527598 TGTCTTTTACAGAACATGGATGG - Intronic
915763990 1:158344428-158344450 TGCCCTTTATAGGACATGGATGG - Intergenic
916786862 1:168092848-168092870 TGTCCTTCGCAGGAGATAACGGG + Intronic
917104897 1:171482680-171482702 TCTCCTTAGCAGCACTTGGATGG - Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
921055285 1:211538438-211538460 TGCCCTTCAGGGGACATGGATGG - Intergenic
921282056 1:213577094-213577116 TGTCCCTCCCACGACATGCAGGG - Intergenic
921298846 1:213730075-213730097 TGTTCTTTACTGGACATGGATGG - Intergenic
1064491471 10:15861518-15861540 TGTACTTCCTAGCACATGGAAGG + Intergenic
1065700014 10:28415732-28415754 TGTCTTTTGCGGAACATGGATGG - Intergenic
1068461211 10:57331569-57331591 TGTCCTTCCAAGGACATGCCTGG - Intergenic
1069935792 10:71915228-71915250 TGGCCTTAGCAGGACATGGGTGG - Intergenic
1070053985 10:72916476-72916498 TGTCCTTTGCAGGGAGTGGATGG - Intronic
1070577672 10:77691902-77691924 GGTCCTTCCCAGGACATGTGGGG + Intergenic
1071090377 10:81911386-81911408 TGTGATTCCCAGGAAATGGAGGG - Intronic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1074022718 10:109600824-109600846 CATCCTTTGAAGGACATGGATGG + Intergenic
1074534713 10:114320533-114320555 TCTCCTTGGCAGGACAGGCAGGG + Intronic
1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG + Intergenic
1075581706 10:123623769-123623791 TCTCACTGGCAGGACATGGATGG - Intergenic
1077210572 11:1369337-1369359 TGTGCTGCGGAGGACAGGGAAGG + Intergenic
1078130060 11:8606142-8606164 TGTCCCTGGCAGGACAGGGTGGG + Intergenic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078864670 11:15286185-15286207 TGTGCTTTGCAGGACATGAGAGG + Intergenic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1081059422 11:38454743-38454765 TATTCTCCGCAGGTCATGGAAGG - Intergenic
1081216058 11:40399811-40399833 TATTTTTCGCATGACATGGAAGG - Intronic
1081307330 11:41529538-41529560 TGTCCTTTGCATGAGATAGAAGG + Intergenic
1082904093 11:58287185-58287207 TGTCTTTTGCAGAACATAGATGG + Intergenic
1083677794 11:64336705-64336727 TGTCCTTCGTGGGACATGGATGG - Intergenic
1083919649 11:65775433-65775455 TGTCCTTTGAAGGATATGGATGG + Intergenic
1084440481 11:69169972-69169994 TGTCCTTCTGAGGACATGACAGG - Intergenic
1084765800 11:71307549-71307571 AGTCCTTTACAAGACATGGAAGG - Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1086236564 11:84638251-84638273 TGTCCTTGGCACCAAATGGAAGG + Intronic
1087585311 11:100112035-100112057 TATCCTTTCCAGCACATGGAGGG + Intronic
1088852948 11:113720351-113720373 TGTCCTTAGCATGGCATGAAAGG + Intergenic
1089144038 11:116311319-116311341 TGTCCTTTTCAGACCATGGAGGG - Intergenic
1089835712 11:121368706-121368728 CGTCGTTCCCAGGACTTGGAAGG + Intergenic
1090428913 11:126629672-126629694 AGGCCTTGGCAGGACATGGGCGG + Intronic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091348666 11:134874774-134874796 AGTCCTTGGAAGGACATGGAAGG + Intergenic
1094539441 12:31351011-31351033 GGTCCTTCCCACGACATGTAGGG - Intergenic
1096461351 12:51822722-51822744 TGTCCTGCAAAGGACATGGCTGG - Intergenic
1097538359 12:60902502-60902524 TGTCATTTGCAACACATGGATGG + Intergenic
1097627840 12:62022231-62022253 AGTCTTTAGCAGGACATGTAAGG - Intronic
1097706015 12:62869011-62869033 TGTACTTCGCAGCACATAGTGGG - Intronic
1098719948 12:73883933-73883955 TGTCCCTCCCAGGACATGTGGGG - Intergenic
1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG + Intronic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1104745428 12:131207514-131207536 TGTCCTCGGCTGGACCTGGAAGG - Intergenic
1104788912 12:131469592-131469614 TGTCCTCGGCTGGACCTGGAAGG + Intergenic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1105737079 13:23282633-23282655 TGCCCTTCTAGGGACATGGATGG - Intronic
1110290400 13:73799099-73799121 CGTCTTTTGCAGCACATGGATGG + Intronic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115764714 14:36611837-36611859 TGTTTTTTGCAGGACATGGATGG + Intergenic
1115790510 14:36872667-36872689 TCTCCTTCGGAGCACCTGGAAGG + Intronic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1116943687 14:50816036-50816058 TGTCCTTTGCAAGACATAGATGG + Intronic
1117842462 14:59873976-59873998 TGTCATTTGCACAACATGGATGG - Intergenic
1119583492 14:75809869-75809891 TGTCATTTGCAGAACATAGATGG - Intronic
1120058955 14:79959374-79959396 TGTCCTTTGAGGGACATGGATGG + Intergenic
1122198320 14:100106577-100106599 TCTCCTTTGCAGTACATGTAAGG + Intronic
1122384734 14:101336609-101336631 TGTCCTTCCCAACAAATGGAAGG - Intergenic
1130181045 15:81628909-81628931 TGTCCTTTGCAGGGCGCGGATGG + Intergenic
1131419519 15:92293013-92293035 TGTCCTTCTGGGGTCATGGATGG + Intergenic
1131640365 15:94285874-94285896 TTTCCTTCCAAGAACATGGATGG + Intronic
1132245293 15:100291679-100291701 TGTCCTCTGCAGCACATGGATGG + Intronic
1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG + Intronic
1132701701 16:1224875-1224897 TTTCCTGAGCAGGACCTGGAGGG - Intronic
1133139640 16:3734702-3734724 TGTCATTCGCAGGACAGAGGAGG - Intronic
1137906106 16:52323525-52323547 GGTCCTTAGCACGACCTGGAAGG - Intergenic
1141483474 16:84322859-84322881 TGTCTTGGGCAGGACAAGGAGGG - Intronic
1141810399 16:86371950-86371972 TGTCCTTCCCATGTTATGGATGG + Intergenic
1145939650 17:28736077-28736099 TGTCCTTTGTAGGACATGGATGG - Intronic
1150990626 17:70254248-70254270 TGTCCTGCCCACCACATGGATGG - Intergenic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1152592813 17:81222230-81222252 TGTCCCTCCCAGGACCTGAAGGG + Intronic
1153002536 18:469013-469035 TGGCGTGCGCAGCACATGGAAGG + Intronic
1153028976 18:695947-695969 TGCCCTTCTCAGTGCATGGATGG + Intronic
1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG + Intronic
1153837250 18:8974975-8974997 TGTCATTTGCAAAACATGGATGG + Intergenic
1154106829 18:11530894-11530916 TGTCCTTCGCAGGCCACGGCAGG - Intergenic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1154340563 18:13498950-13498972 TGTCCACAGCAGGACATGTATGG - Intronic
1156493720 18:37512099-37512121 TGTCCTTCGCTGGGCTGGGAGGG + Intronic
1156668841 18:39442723-39442745 TGTCCCTCTCATGACATGTAGGG - Intergenic
1156715364 18:40002561-40002583 TGTATTTTGCAGAACATGGATGG + Intergenic
1157098372 18:44707969-44707991 TGTGCTTCTCAGGACATGCCAGG - Intronic
1159421669 18:68228750-68228772 TGTCCCAAGGAGGACATGGAGGG + Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1161897181 19:7091180-7091202 TGCCCTTCTCAGGACATAGCTGG - Intergenic
1165945797 19:39441461-39441483 TGTCCTTCACAGGACAGGCAAGG - Intronic
927408436 2:22798131-22798153 TTTCCTTCTCAGTACAAGGATGG + Intergenic
930191593 2:48465723-48465745 TGTCCTTTGCAGTACTTGGATGG - Intronic
931502148 2:62881080-62881102 TGTTCTTTGCAGCACATGGATGG + Intronic
931531605 2:63221005-63221027 TGTCCTTTGAGGGACAGGGATGG - Intronic
931779762 2:65568808-65568830 TGGCCTTTGCAGCACATGGGTGG - Intergenic
931798415 2:65734362-65734384 TTTTTTTTGCAGGACATGGATGG - Intergenic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
933196614 2:79397372-79397394 TGTCCTTGGCTGGAAAAGGAAGG - Intronic
933492294 2:83001372-83001394 TGTCCCTCTCAGGACAGAGATGG - Intergenic
933698765 2:85239333-85239355 TGTCCGTGGCAGGGCAGGGAGGG - Intronic
934627946 2:95879136-95879158 TCTCATTCACATGACATGGATGG + Intronic
937464304 2:122116921-122116943 TGTCATTTTCAGCACATGGATGG - Intergenic
937735966 2:125289750-125289772 TGTCCTTTGCGGGACATGGATGG - Intergenic
939114807 2:138048491-138048513 GGTCCCTCCCAGGACATGTAGGG - Intergenic
940621854 2:156122495-156122517 GGTCCTTCCCATGACATGTAGGG - Intergenic
943334528 2:186597896-186597918 TTTCCTTCCCTGGACATAGAGGG - Intronic
945377472 2:209096304-209096326 TGCTCTTTGCAGAACATGGATGG - Intergenic
947169797 2:227299497-227299519 GGTCCTTCCCAGGACATGTGGGG + Intronic
947393144 2:229660424-229660446 TGTCCTTGCAGGGACATGGATGG - Intronic
948244944 2:236472966-236472988 CTTCCTTCCCAGGACATGTAGGG + Intronic
948547709 2:238744710-238744732 TGTGCTTCCCAGGAGATGGCTGG + Intergenic
949034547 2:241810511-241810533 TGCCCTTCGCAGGGGAGGGAGGG + Intronic
1170282260 20:14663170-14663192 TGTTCTTTGTAGGACAGGGATGG + Intronic
1170331314 20:15213829-15213851 TGTCCTTCCTAGGACATGGCTGG - Intronic
1172391969 20:34571664-34571686 TGGGCTGCGCAGGACATGCAAGG + Intronic
1174431739 20:50475113-50475135 TGTCCTCTGCAGGGCATGGCAGG + Intergenic
1175114268 20:56671004-56671026 AGTCTTTCCCAGCACATGGAGGG + Intergenic
1176254712 20:64145949-64145971 AGGCCTGGGCAGGACATGGAGGG - Intergenic
1177218562 21:18160637-18160659 TGTCCTTGCAGGGACATGGATGG - Intronic
1178081039 21:29065325-29065347 GGTTCTTCCCAGTACATGGAAGG - Intronic
1178185153 21:30209899-30209921 AGTCCTTCTCAGGACAAGGAAGG + Intergenic
1179821675 21:43940616-43940638 TGTCCGTCCCAGGACATGCCAGG - Intronic
1180006742 21:45026167-45026189 AGGCCTGCGCAGGCCATGGATGG - Intergenic
1180818035 22:18805188-18805210 TGTCCTTCGCATGAGAGTGAGGG - Intergenic
1181204253 22:21239643-21239665 TGTCCTTCGCATGAGAGTGAGGG - Intergenic
1182727775 22:32461508-32461530 TCTGCCTCTCAGGACATGGAGGG - Intronic
1183492367 22:38123388-38123410 TGTCCTATGCAGGACAGCGAGGG + Intronic
1183587672 22:38762449-38762471 TGTCCTGGGCAGGACTTGGGTGG - Intronic
1184931062 22:47681819-47681841 TGTGCTCAGCAGGACATGGTGGG + Intergenic
1185034063 22:48461662-48461684 GGACCTCCGCAGGACAGGGAAGG + Intergenic
1185306491 22:50120378-50120400 AGTTCTTCTCAGGAAATGGATGG + Intronic
1203222669 22_KI270731v1_random:55772-55794 TGTCCTTCGCATGAGAGTGAGGG + Intergenic
1203268160 22_KI270734v1_random:31042-31064 TGTCCTTCGCATGAGAGTGAGGG - Intergenic
953816016 3:46157387-46157409 TGTCCTTTGCAAGGAATGGATGG - Intergenic
954364988 3:50140848-50140870 TGTCCTCCGCAGGACCAGGGCGG - Intergenic
955198599 3:56829258-56829280 TGTCTTCCGCAGGCCCTGGATGG - Intronic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
959182052 3:102993458-102993480 GGTCCTTCGCATGACATGTGGGG - Intergenic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
960825996 3:121785169-121785191 TGTCCTTGGCAGGAAAAGAAAGG - Intronic
961627212 3:128272396-128272418 TCTCCTTCACTGGACATTGAAGG + Intronic
961971551 3:130973587-130973609 TGTCCTTGGCAGGACAGAGTGGG + Intronic
962089391 3:132227327-132227349 TGTCCTTTGCAGGGAATGGAGGG - Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
963747381 3:149138513-149138535 TGTAATTTGGAGGACATGGATGG + Intronic
964344398 3:155741487-155741509 TGTCATTCCTAGGACATAGACGG - Intronic
965989265 3:174796526-174796548 TGTCTTTAGCACAACATGGATGG - Intronic
965993851 3:174854218-174854240 TATCTTTTGCAGTACATGGATGG + Intronic
966654800 3:182343833-182343855 TGTTCTTTGCAGCACATGGATGG - Intergenic
967787605 3:193514384-193514406 TGTCCTTTTCAGGACATGGATGG - Intronic
968963631 4:3758323-3758345 TGGCCTTCACAGCACAGGGAAGG - Intergenic
969082570 4:4630667-4630689 TGTCCCCTGCAGGACATGGATGG + Intergenic
970836104 4:20409373-20409395 TGTCCTTTTAGGGACATGGATGG - Intronic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
972910663 4:43812649-43812671 TGTCCTTTGCAGAGCGTGGATGG + Intergenic
972984854 4:44750733-44750755 TGTCCTTTCCGGGACATGGATGG - Intergenic
972986729 4:44774220-44774242 TGTCCTTAGGATGACCTGGAGGG - Intergenic
974495436 4:62620198-62620220 TCTCCTTGGCAGAACATAGAAGG + Intergenic
975398816 4:73910098-73910120 TGTCCTTGTAGGGACATGGATGG + Intergenic
975889090 4:79003447-79003469 TGTCCTTTCAGGGACATGGATGG + Intergenic
976793270 4:88904456-88904478 TGTCCTTTCTAGGACATGGATGG + Intronic
977520153 4:98072248-98072270 TGTCCTTTGCGGGACATGAATGG + Intronic
980187721 4:129482706-129482728 TGTCTTTCGCACGACATCTATGG + Intergenic
980282758 4:130741797-130741819 TATCCTTTGGAGAACATGGATGG - Intergenic
980857486 4:138456601-138456623 TGTGCTGTGCAGGACATGGATGG + Intergenic
981992913 4:150944816-150944838 GGTCCTTCCCACGACATGTAGGG - Intronic
983155620 4:164344063-164344085 TGTCCTTTGCACAGCATGGATGG + Intronic
983419459 4:167499643-167499665 TTTTTTTTGCAGGACATGGATGG - Intergenic
983462341 4:168043008-168043030 TGTACTTTGCAGCACTTGGATGG + Intergenic
983499432 4:168482272-168482294 TGCCCTTACCAGGACATTGAAGG + Intronic
984628016 4:182030384-182030406 TGTCTTTTGCAGGACAGGGATGG - Intergenic
985038070 4:185861299-185861321 TGTCCTTCGCTGAAAATGGGGGG + Intronic
986706049 5:10455603-10455625 TATCCTGTGCAGGACAGGGATGG - Intronic
989962678 5:50435250-50435272 TGTCCTTTGTAGGAAATAGACGG - Intronic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993247684 5:85471655-85471677 TGTCCTTTGCAAAACATGGATGG + Intergenic
993568689 5:89508562-89508584 TGTCTTTTGCGGAACATGGATGG + Intergenic
993795118 5:92257490-92257512 TGTCCTTTGCAGCATACGGATGG + Intergenic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
994057371 5:95433422-95433444 GGTCCTTCTCATGACATGTAGGG + Intronic
994166112 5:96610026-96610048 TGTCCCTCCCAGGACATGTGGGG - Intronic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
994803897 5:104418115-104418137 TGTCCTTGCAAGAACATGGATGG + Intergenic
995059044 5:107794179-107794201 TGTCCTTTGCAAAACATGGATGG + Intergenic
995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG + Intronic
995621904 5:114034868-114034890 TGTTCTTTGCAGAACATGGATGG - Intergenic
995886233 5:116897275-116897297 TGTCCATCTCAGTAAATGGAAGG - Intergenic
996475437 5:123914534-123914556 TGTCTTTGCCAGGACATGCATGG + Intergenic
996951925 5:129137364-129137386 TGTCTTTGCAAGGACATGGATGG + Intergenic
997363937 5:133313340-133313362 TGTCCTGGGCAGGACAAGGCAGG - Intronic
997785989 5:136714456-136714478 TGTCCTTTGCAGAAAATGGATGG - Intergenic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
999939221 5:156522423-156522445 TGCCCTTTTCAGGACATAGATGG + Intronic
1000189600 5:158897255-158897277 TGTCCTTTGCGGGACATGGATGG + Intronic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1002069790 5:176672338-176672360 TGTCCTCTGCAGGACCTGCAGGG - Intergenic
1002967748 6:1984058-1984080 TGTCCTTTGTGGGACATGGATGG + Intronic
1003740886 6:8937684-8937706 TGTCCTTGCAGGGACATGGATGG - Intergenic
1004247001 6:13988021-13988043 TGCCCTTAGGAGGACAGGGAAGG - Intergenic
1004918753 6:20356746-20356768 TGTCTCTCTGAGGACATGGATGG + Intergenic
1005919240 6:30384100-30384122 TGTCCTTTGCGGAACATGGATGG - Intergenic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1008832604 6:55785071-55785093 TGTCCATCACAGGAAATGCATGG + Intronic
1010802081 6:80188165-80188187 TGTCCTTTGCAGGACATATCTGG + Intronic
1011055930 6:83203388-83203410 TGTCCTTCCCAGGCCATGTGGGG + Intergenic
1012013873 6:93829882-93829904 GGTCCTTCCCAGGAAATGTAGGG - Intergenic
1013896723 6:115097553-115097575 TGTCCTCTGCAGGACGTGAACGG - Intergenic
1014012775 6:116495317-116495339 TGTCATTTGCAAAACATGGATGG - Intronic
1014375300 6:120664774-120664796 TGTCCTTTGCAGGGCATGGATGG - Intergenic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1021199500 7:17712350-17712372 TGCCCTTTGCGGGACATAGATGG + Intergenic
1021364247 7:19756750-19756772 GGTCTTTTGCAGGACATGGATGG - Intronic
1027485875 7:78761232-78761254 TCTCTTTCCCAGGACATGCAAGG + Intronic
1028170354 7:87588484-87588506 CGTCCTTTGCAGGGCATGGCTGG - Intronic
1029160710 7:98549438-98549460 TGTCCATTGCAGGAGATGCAGGG - Intergenic
1031562987 7:123260626-123260648 TGTCCTTCTAAGGACAAGGAAGG - Intergenic
1032081547 7:128861002-128861024 TGGCCTGTGCAGCACATGGATGG - Intergenic
1032087841 7:128893066-128893088 TGTCCTGGGAAGGACAGGGATGG - Intronic
1032389374 7:131546091-131546113 TTTCCTTCTCAGGAAAGGGAGGG - Intronic
1033737207 7:144234309-144234331 TATCCTTTGATGGACATGGATGG + Intergenic
1033745850 7:144316637-144316659 TGTCCTTTGATGGACATGGATGG - Intergenic
1034937880 7:155211437-155211459 TGGCCTTTGCAGGTCATGGTGGG - Intergenic
1035414200 7:158669072-158669094 TGTTCTTTGCAGGGAATGGATGG - Intronic
1037206135 8:16321648-16321670 AGTCCTTCCCACGATATGGAGGG - Intronic
1040655045 8:49498297-49498319 GGTCCTTCCCATGACATGTAGGG - Intergenic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1042312617 8:67393830-67393852 TCTCCCTCGCAGGAGAGGGAAGG + Intergenic
1043001536 8:74766019-74766041 TGTCCTTTGCAGGAACAGGATGG + Intronic
1043325044 8:79039759-79039781 TGTCATTTGCAGGACATGATTGG + Intergenic
1045567734 8:103338605-103338627 TGTCCCTCCCATGACATGTAGGG + Intergenic
1046418965 8:113954180-113954202 TGTCCTTAGCTGGAGATGTAAGG + Intergenic
1046835384 8:118795276-118795298 GGTCCCTCCCAGGACATGTAGGG - Intergenic
1048078295 8:131097389-131097411 TGTCTTTGCAAGGACATGGATGG + Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1049283085 8:141760459-141760481 TGGGCTTCGCAGGCCATGGAAGG + Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1052572080 9:30239617-30239639 TGTCCTTCGTTGTACATGAATGG - Intergenic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1055281731 9:74682013-74682035 TTTCAGTCGAAGGACATGGAAGG - Intronic
1056485337 9:87051301-87051323 TGTCTTTTGCAGAGCATGGATGG + Intergenic
1056844702 9:90027133-90027155 TGTGATTTGCAGGACATAGAAGG - Intergenic
1058234177 9:102468524-102468546 TGTCCTTTGAGGGACGTGGACGG + Intergenic
1058406463 9:104681056-104681078 TGTCATTTGCACAACATGGATGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1059831700 9:118103394-118103416 TGTCCTTTGCAGGGCATGGGTGG + Intergenic
1061185057 9:129048231-129048253 GGTCATGAGCAGGACATGGAGGG + Intronic
1186051300 X:5598504-5598526 CGTCTTTTGCAGAACATGGATGG - Intergenic
1187640241 X:21279763-21279785 TGTCTTTTGCAGGACATGAATGG - Intergenic
1187640561 X:21284263-21284285 TGTCCTTGGCAGGACGTGGATGG + Intergenic
1187724560 X:22189082-22189104 TGTCATTTGCAACACATGGATGG - Intronic
1188090620 X:25960196-25960218 TTTCTTTTGCAGGGCATGGATGG - Intergenic
1189926742 X:45962709-45962731 TGTACTTTGCAGCACATGCATGG + Intergenic
1190373915 X:49769975-49769997 TGTCCTTTGTGGGATATGGATGG - Intergenic
1191026762 X:55922302-55922324 TGTCCTTTGTAGGACATGGATGG + Intergenic
1193877172 X:86874399-86874421 TGTCCTGTGCAGGACACAGATGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1195207668 X:102619246-102619268 TGTCCTTTGCAGCAAATTGATGG - Intergenic
1195213602 X:102674448-102674470 TGTCCTTTCAGGGACATGGATGG - Intergenic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1199878097 X:151950956-151950978 TGTCATTCTCAGGCCATGGCTGG - Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1201537193 Y:15063406-15063428 TGTAGCTTGCAGGACATGGATGG - Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic