ID: 995357654

View in Genome Browser
Species Human (GRCh38)
Location 5:111257968-111257990
Sequence TGTGTGTTGTTCCCCTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 267}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995357654_995357669 12 Left 995357654 5:111257968-111257990 CCATCTCAGGGGAACAACACACA 0: 1
1: 0
2: 4
3: 25
4: 267
Right 995357669 5:111258003-111258025 ACGGGGAGGGTGTCGGGGGAGGG No data
995357654_995357668 11 Left 995357654 5:111257968-111257990 CCATCTCAGGGGAACAACACACA 0: 1
1: 0
2: 4
3: 25
4: 267
Right 995357668 5:111258002-111258024 CACGGGGAGGGTGTCGGGGGAGG 0: 1
1: 1
2: 0
3: 49
4: 479
995357654_995357658 -7 Left 995357654 5:111257968-111257990 CCATCTCAGGGGAACAACACACA 0: 1
1: 0
2: 4
3: 25
4: 267
Right 995357658 5:111257984-111258006 ACACACACTGGGGCCTAGCACGG No data
995357654_995357660 -5 Left 995357654 5:111257968-111257990 CCATCTCAGGGGAACAACACACA 0: 1
1: 0
2: 4
3: 25
4: 267
Right 995357660 5:111257986-111258008 ACACACTGGGGCCTAGCACGGGG 0: 1
1: 0
2: 78
3: 1470
4: 3509
995357654_995357662 -1 Left 995357654 5:111257968-111257990 CCATCTCAGGGGAACAACACACA 0: 1
1: 0
2: 4
3: 25
4: 267
Right 995357662 5:111257990-111258012 ACTGGGGCCTAGCACGGGGAGGG 0: 1
1: 0
2: 4
3: 76
4: 1233
995357654_995357666 7 Left 995357654 5:111257968-111257990 CCATCTCAGGGGAACAACACACA 0: 1
1: 0
2: 4
3: 25
4: 267
Right 995357666 5:111257998-111258020 CTAGCACGGGGAGGGTGTCGGGG 0: 1
1: 0
2: 0
3: 5
4: 104
995357654_995357665 6 Left 995357654 5:111257968-111257990 CCATCTCAGGGGAACAACACACA 0: 1
1: 0
2: 4
3: 25
4: 267
Right 995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG 0: 1
1: 0
2: 0
3: 4
4: 108
995357654_995357661 -2 Left 995357654 5:111257968-111257990 CCATCTCAGGGGAACAACACACA 0: 1
1: 0
2: 4
3: 25
4: 267
Right 995357661 5:111257989-111258011 CACTGGGGCCTAGCACGGGGAGG 0: 1
1: 1
2: 36
3: 1004
4: 2929
995357654_995357670 23 Left 995357654 5:111257968-111257990 CCATCTCAGGGGAACAACACACA 0: 1
1: 0
2: 4
3: 25
4: 267
Right 995357670 5:111258014-111258036 GTCGGGGGAGGGAGAGTATCAGG No data
995357654_995357663 5 Left 995357654 5:111257968-111257990 CCATCTCAGGGGAACAACACACA 0: 1
1: 0
2: 4
3: 25
4: 267
Right 995357663 5:111257996-111258018 GCCTAGCACGGGGAGGGTGTCGG 0: 1
1: 0
2: 0
3: 8
4: 148
995357654_995357659 -6 Left 995357654 5:111257968-111257990 CCATCTCAGGGGAACAACACACA 0: 1
1: 0
2: 4
3: 25
4: 267
Right 995357659 5:111257985-111258007 CACACACTGGGGCCTAGCACGGG 0: 1
1: 5
2: 280
3: 2121
4: 4826
995357654_995357667 8 Left 995357654 5:111257968-111257990 CCATCTCAGGGGAACAACACACA 0: 1
1: 0
2: 4
3: 25
4: 267
Right 995357667 5:111257999-111258021 TAGCACGGGGAGGGTGTCGGGGG 0: 1
1: 0
2: 1
3: 6
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995357654 Original CRISPR TGTGTGTTGTTCCCCTGAGA TGG (reversed) Intronic
900500226 1:3000858-3000880 TGTGTGTCATTCCTCTGGGAAGG + Intergenic
900623566 1:3598207-3598229 GGTGTTTTGTTACCCAGAGACGG - Intronic
900831782 1:4970599-4970621 TGTGTGTTTATCCTCTGAAACGG + Intergenic
903193763 1:21670207-21670229 TGTGGGCTGTTCCCCGGGGAGGG - Intergenic
906250588 1:44308020-44308042 TGTGTGTTATTGCCCTGGAAGGG - Intronic
906880593 1:49585143-49585165 TGTAGTTTGTTCCCCAGAGAAGG - Intronic
910448382 1:87322116-87322138 TGTGTGGTTTACTCCTGAGAGGG - Intergenic
911111888 1:94197904-94197926 TGAGTGCTTTTCCCCTAAGATGG + Intronic
912641156 1:111347001-111347023 TGTGGGGTGATCCCCTAAGAGGG - Exonic
913295008 1:117310853-117310875 TGTGTGATGTATCCCTGAGAAGG - Intergenic
913467641 1:119158795-119158817 TTTTTTTTTTTCCCCTGAGACGG - Intergenic
913541717 1:119827362-119827384 TTTGTGATGCTCCACTGAGAAGG + Intergenic
915835898 1:159174355-159174377 TGTGTTTCGTACCCCTGAGTTGG + Intronic
916880061 1:169012019-169012041 TGGGTGTTCTTACCCTGAAAAGG - Intergenic
917683989 1:177397184-177397206 TGTGTCCTGTTCCCTTGACAGGG - Intergenic
917701864 1:177589851-177589873 TGTGTGCTGAGCACCTGAGATGG - Intergenic
917883957 1:179365539-179365561 TCTCTTTTTTTCCCCTGAGACGG - Intergenic
918572272 1:186011050-186011072 TTTTTGCTTTTCCCCTGAGAGGG + Intronic
921764929 1:218960301-218960323 TGTGTGTTGTTCCCCTCTATGGG + Intergenic
924799875 1:247321169-247321191 TGTTTTTTTTTCCCCCGAGATGG - Intronic
1063307348 10:4917055-4917077 TGTGTGTTGTTCCCCTCTCTGGG - Intergenic
1065641666 10:27788446-27788468 TGTGTGATGTTCCCCTTAAGGGG + Intergenic
1065791544 10:29264995-29265017 TGTGTGTTGTTCCCCTCTACAGG - Intergenic
1066708976 10:38212603-38212625 AGTGTGTTGTTGCCCTGACAAGG - Intergenic
1066980524 10:42409890-42409912 AGTGTGTTGTTGCCCTGACAAGG + Intergenic
1068137013 10:52959898-52959920 TGTGTGTTTTCCCTCTGAGATGG + Intergenic
1068461342 10:57333568-57333590 TATGTGTTGTTCTCATGATAGGG + Intergenic
1070817800 10:79336139-79336161 TGGGTGTGGTTCCCCTGGGCTGG - Intergenic
1071375885 10:85002752-85002774 TGTTTGATTTTTCCCTGAGACGG + Intergenic
1071671562 10:87613720-87613742 TTTTTTTTTTTCCCCTGAGATGG - Intergenic
1072330930 10:94351158-94351180 TGTTTGTTCTTCCAGTGAGAGGG - Intronic
1072365576 10:94705325-94705347 TGTGTGTTGTTCCCCTCCCTGGG - Intronic
1072404612 10:95138159-95138181 TGTGTCTTTTTCACATGAGATGG - Intergenic
1072565731 10:96615270-96615292 TGTGTGATTTTACCCTGAGTGGG + Intronic
1073853308 10:107645999-107646021 TTGGTGGTGTGCCCCTGAGATGG - Intergenic
1074294053 10:112166122-112166144 TGTTTTTTGTTCCCCTTAGATGG + Intronic
1074352162 10:112748169-112748191 TGGGTGATGTTGCCCTGAGCCGG - Intronic
1074816042 10:117141124-117141146 TGTTTGTTGTTTGTCTGAGACGG + Intergenic
1076393100 10:130118653-130118675 TGTTTGTTTTTCCCCCAAGACGG + Intergenic
1079443492 11:20538354-20538376 TGTGTGTTGTTCCCCTGTTGCGG + Intergenic
1080352219 11:31398634-31398656 TGGGTGCTTTACCCCTGAGATGG - Intronic
1082069635 11:47928527-47928549 TGTGTGTTGTGCGCCTGTTATGG - Intergenic
1082283407 11:50296627-50296649 TTTGTTTTGTTTTCCTGAGATGG - Intergenic
1083102299 11:60320951-60320973 TGTGTGTTGTTCCCCTCCCTGGG + Intergenic
1084914766 11:72420487-72420509 TTTTTTTTTTTCCCCTGAGATGG - Intronic
1085434104 11:76483507-76483529 TGTGTGTCTTTCACATGAGATGG - Intronic
1087706447 11:101497881-101497903 TGTGTGATGTTCCCAAAAGAGGG + Intronic
1089147496 11:116340521-116340543 GGTGTGTTCTTCCCCTAAGTGGG - Intergenic
1089450395 11:118591394-118591416 TTTGTTTTGTTTTCCTGAGATGG + Intronic
1091544407 12:1491654-1491676 TGTTTGTTATTGCCCTTAGAGGG + Exonic
1091974968 12:4817107-4817129 TGTGTGTTATTGCCATGGGAAGG + Intronic
1092379071 12:7980061-7980083 TTTTTTTTTTTCCCCTGAGATGG - Intergenic
1092379155 12:7980579-7980601 TTTTTTTTTTTCCCCTGAGATGG - Intergenic
1093880725 12:24401345-24401367 TTTTTTTTTTTCCCCTGAGATGG - Intergenic
1094483404 12:30903594-30903616 ATTATGTTGTTCCCCTAAGATGG - Intergenic
1097322099 12:58237220-58237242 TGTGTGTAGTTTTCCTGACAGGG + Intergenic
1097772414 12:63603548-63603570 TGTGTGTTGTTCCCCTCCCTGGG + Intronic
1101387472 12:104270729-104270751 TGTATGTTTTTCCTCCGAGAAGG + Intronic
1102765840 12:115432156-115432178 TGTGTTTTTTTCCCCATAGATGG - Intergenic
1105325378 13:19365792-19365814 TGTTTGTTTTTCCACTCAGAAGG + Intergenic
1105489213 13:20871183-20871205 TTTGTTTTGTTTTCCTGAGACGG + Intronic
1105725306 13:23157580-23157602 TTTTTTTTTTTCCCCTGAGATGG + Intergenic
1106869510 13:34003449-34003471 TGTGTGGGGTTGCCCTCAGAGGG + Intergenic
1107100779 13:36588693-36588715 TGTGTCTTGTGCCCCTTAGTTGG + Intergenic
1107237954 13:38196065-38196087 GATGTCTTCTTCCCCTGAGATGG + Intergenic
1107593253 13:41931142-41931164 TTTTTTTTTTTCCCCTGAGACGG - Intronic
1108227075 13:48300918-48300940 TGTGTGTTGTTCCCCTTCCTGGG + Intergenic
1109379086 13:61535093-61535115 TGTATGTTGTTCCCCAGTGAAGG - Intergenic
1109490730 13:63096713-63096735 TGTGTGGTGTTCCTCTGAGTGGG - Intergenic
1110402847 13:75114154-75114176 TGTGTGTTGTTCCCCTCTCTGGG - Intergenic
1112716699 13:102194455-102194477 TGTGTGTTGTTCCCCTGCTAGGG + Intronic
1113185922 13:107685306-107685328 TGTTTGTTTTTTTCCTGAGACGG - Intronic
1114863393 14:26555495-26555517 AGTGTGTTGTACCTCTGAGAAGG - Intronic
1116651069 14:47593690-47593712 TGTGTGTTGTTCCCCTCCCTGGG - Intronic
1116826177 14:49675756-49675778 TGTTTGTTGTTTGTCTGAGATGG + Intronic
1117692312 14:58320610-58320632 TTTTTTTTTTTCCCCTGAGACGG + Intronic
1118031895 14:61826191-61826213 TGTGTGTGAGTGCCCTGAGATGG - Intergenic
1118072956 14:62265634-62265656 TGGGTGTTATTCCCATGGGATGG + Intergenic
1119055422 14:71414372-71414394 TTTGTTTTTTTTCCCTGAGATGG - Intronic
1123504088 15:20921022-20921044 TTTTTTTTTTTCCCCTGAGATGG + Intergenic
1123561335 15:21494716-21494738 TTTTTTTTTTTCCCCTGAGATGG + Intergenic
1123878665 15:24652709-24652731 TGTGTGTTGTCCCCCTGTAGTGG - Intergenic
1124144508 15:27111633-27111655 TGTGTGCTGTTCTTCAGAGAGGG + Intronic
1125121481 15:36164073-36164095 TGTGTGTTTTTTCTTTGAGACGG + Intergenic
1126704709 15:51396388-51396410 TGTCTGCTTTTCCCCTGAGCTGG - Intronic
1129433487 15:75518810-75518832 TTTTTTTTTTTCCCCTGAGATGG - Intronic
1131494452 15:92893870-92893892 TTTTTTTTTTTCCCCTGAGACGG + Intronic
1131668226 15:94592640-94592662 TGTGTGTGGGTCCCTTGAGAGGG - Intergenic
1202969681 15_KI270727v1_random:221852-221874 TTTTTTTTTTTCCCCTGAGATGG + Intergenic
1132589448 16:720340-720362 TGTGTGTTGTTTTCTGGAGAAGG + Intronic
1133233351 16:4376651-4376673 TGTGTGGTGTACCCCAGAGGTGG + Intronic
1133591403 16:7247852-7247874 TGTGTGTTGTTCCCCTCTATGGG - Intronic
1134487592 16:14670573-14670595 TGTATTTTTTCCCCCTGAGATGG - Intergenic
1137004191 16:35257314-35257336 TGTGTTTCGTTCTCCTGTGAAGG - Intergenic
1137223345 16:46477808-46477830 TGTGTGTTGTTTTTTTGAGATGG - Intergenic
1137387336 16:48053899-48053921 TGTGTCTTGCTCCCCAAAGATGG - Intergenic
1137476728 16:48815852-48815874 TGTGTGTTGTTCCCCTTTATGGG - Intergenic
1138807115 16:60103238-60103260 TGTGTGTTGTTCCCCTCCCTGGG + Intergenic
1139197631 16:64939301-64939323 TGTCTGTTGTTCCCCTCTGTGGG - Intergenic
1140344938 16:74203872-74203894 TTTTTGTTTTTCCCTTGAGATGG - Intergenic
1141525261 16:84607008-84607030 GGTGTGTTGCTCCCTTGAGTGGG - Intronic
1141805618 16:86339465-86339487 TGTCTGTTGTTCCCCTCTGTGGG + Intergenic
1141968529 16:87463818-87463840 TGTTTTTTTTTCTCCTGAGACGG - Intronic
1142520662 17:502520-502542 TTTTTTTTTTTCCCCTGAGATGG + Intergenic
1142701275 17:1662582-1662604 TTTTTTTTTTTCCCCTGAGATGG - Intronic
1143259794 17:5589810-5589832 TTTTTTTTTTTCCCCTGAGATGG + Intronic
1143311074 17:5989731-5989753 TGTGTGATGTTCCCCTGTGCTGG + Intronic
1143555230 17:7655722-7655744 TGTGTGTAGTTCACCTGGGCCGG - Exonic
1143766912 17:9143852-9143874 TTTGTGATGTTCCCCTGACATGG + Intronic
1147260623 17:39208000-39208022 TTTTTTTTTTTCCCCTGAGATGG - Intergenic
1148822304 17:50366725-50366747 ACTGTGGTGTTCCCCTGAGCAGG - Intergenic
1150870045 17:68897262-68897284 TGTGCATTATTCCCCTGAGATGG - Intronic
1153478585 18:5524196-5524218 TGTTTTTTGTTTTCCTGAGATGG + Intronic
1158084514 18:53635137-53635159 TGTGTGATGTTCCCCTTAAGGGG - Intergenic
1159483170 18:69017293-69017315 TGTGTGTTTTTCTGCAGAGATGG + Intronic
1160574143 18:79840030-79840052 TGAATGTTCTTCCCCTCAGATGG + Intergenic
1160795699 19:944491-944513 TGAGCGTGGTGCCCCTGAGATGG - Intronic
1162450849 19:10753659-10753681 TTTGTTTTTTTCCCCCGAGACGG + Intronic
1164826804 19:31290060-31290082 CAGGTGTGGTTCCCCTGAGAAGG - Intronic
1165047755 19:33119154-33119176 AGTGTGTGATTGCCCTGAGATGG + Intronic
925818844 2:7779309-7779331 AGCCTGGTGTTCCCCTGAGAAGG + Intergenic
925887640 2:8406796-8406818 TTTTTTTTTTTCCCCTGAGATGG - Intergenic
926820188 2:16843403-16843425 TGTGTGTTGTTCCCCTCCCTGGG + Intergenic
927567908 2:24129989-24130011 TGTGTGTTGTTCCCCTCCCTGGG + Intronic
927723361 2:25401960-25401982 TGTTTTTTGTTTCTCTGAGAGGG - Intronic
931612578 2:64118636-64118658 TGTTTGTTCTTCCTCTGATATGG - Intronic
935017313 2:99196074-99196096 TTTTTTTTTTTCCCCTGAGATGG - Exonic
935477769 2:103545020-103545042 TGTGTATTGTTCCTCTAAAAAGG + Intergenic
935542390 2:104364249-104364271 TGTGTGTTGTTCCCCCATGTCGG - Intergenic
936401670 2:112169266-112169288 TGTTTGTTTTTCTCCCGAGACGG - Intronic
937762603 2:125623674-125623696 TGTGTGTCTTTGCACTGAGATGG - Intergenic
938155235 2:128932130-128932152 TTTGTTTTGTTTTCCTGAGAGGG + Intergenic
938210632 2:129463544-129463566 TTTTTTTTTTTCCCCTGAGATGG - Intergenic
939825534 2:147010997-147011019 TGTGTGTTGTTTCTTTGAGGAGG - Intergenic
940068609 2:149657902-149657924 TGTTTGTTGTTCCTCTGTCATGG - Intergenic
941743229 2:169058764-169058786 TGTGTGTTGTTCCCCTCCCTGGG - Intergenic
941773968 2:169371892-169371914 TGTGTGTTGTTCCCCTCCCTGGG - Intergenic
942502503 2:176606345-176606367 ATTGTCTTTTTCCCCTGAGAAGG - Intergenic
942562124 2:177231356-177231378 TGAGTGCTCTGCCCCTGAGATGG + Exonic
944269595 2:197766573-197766595 TGTATGTAGCTCCCCTGTGATGG - Exonic
945122579 2:206472604-206472626 TTTTTTTTTTTCCCCTGAGATGG - Intronic
945290586 2:208123650-208123672 TGTGTGTTGCTCTCCTTTGAAGG + Intronic
945610697 2:211998033-211998055 TGTGTGATGTTCCCAGGGGAGGG + Intronic
945982942 2:216329018-216329040 TGTTTGTTGTTTTTCTGAGACGG - Intronic
947083862 2:226428741-226428763 TGTGTGTGTTTCCCCAGGGATGG + Intergenic
948053324 2:234994193-234994215 TGTGAGTTGAAGCCCTGAGAGGG + Intronic
1169478827 20:5958361-5958383 TGTGTTTTGTTTTCTTGAGATGG - Intronic
1169728805 20:8764701-8764723 TGTGAGTTGTACCACTGAGCTGG - Intronic
1170242456 20:14183207-14183229 TGTGTGTTGTTCCCCTCTATGGG + Intronic
1170243966 20:14200337-14200359 TGTGTGTTGTTCCCCTCTATGGG - Intronic
1173247264 20:41345279-41345301 TTTGTGTGGTTCCACTGGGATGG - Intronic
1174645383 20:52080932-52080954 TGTCTCTTGTTTCCTTGAGATGG - Intronic
1176523132 21:7839993-7840015 TGTGTGTTATTCCCCTCACGTGG - Intergenic
1176629265 21:9121943-9121965 TTTTTTTTTTTCCCCTGAGACGG + Intergenic
1177192148 21:17864019-17864041 TTTGTGTTGTTTCACTGATAAGG - Intergenic
1177936422 21:27352152-27352174 TGTGTGTAGCTCCCCTGTGTGGG - Intergenic
1178418911 21:32427705-32427727 TTTTTTTTTTTCCCCTGAGATGG - Intronic
1178657152 21:34470005-34470027 TGTGTGTTATTCCCCTCACGTGG - Intergenic
1179727059 21:43346619-43346641 TGTGTGTGCTTCCCCTGAGGCGG - Intergenic
1179922933 21:44516876-44516898 TGTGTTTTCTTCCTCTGGGAAGG - Intronic
1180629929 22:17221464-17221486 TGTGTGATGTTCCCCTTGAAGGG + Intronic
1180635868 22:17262605-17262627 TTTTTCTTTTTCCCCTGAGATGG - Intergenic
1180751615 22:18128549-18128571 ATTGTATTTTTCCCCTGAGATGG + Intronic
1181286958 22:21759202-21759224 TGTTTCCTGTTCCCCTCAGATGG + Exonic
1181544688 22:23595278-23595300 TGTGTATTCATCCCCTGAGAAGG + Intergenic
1181815625 22:25434617-25434639 TGTGTATTCATCCCCTGAGAAGG - Intergenic
1182888501 22:33796779-33796801 TTTTTTTTTTTCCCCTGAGATGG + Intronic
950577852 3:13843749-13843771 TTTTTTTTTTTCCCCTGAGATGG + Intronic
951805035 3:26634587-26634609 TGTTGGCTGTTCCCTTGAGATGG + Intronic
952039424 3:29243699-29243721 TTTGTTTTTTTCTCCTGAGATGG - Intergenic
952302671 3:32117811-32117833 TGTGTGTTGTTCTCCTGAGTGGG + Intronic
952530509 3:34257740-34257762 TGTTTGTTTTTGCCCTGAGTTGG + Intergenic
952717948 3:36500409-36500431 TGTGTGTTGTTCCCCTCCCTGGG - Intronic
955075640 3:55610491-55610513 TGTGTGTTTTTCCGTAGAGATGG - Intronic
955308726 3:57862311-57862333 TGTTTGTTTTTCCTTTGAGATGG - Intronic
956769310 3:72511160-72511182 TGTGTGTGTGTGCCCTGAGAAGG - Intergenic
957049842 3:75403169-75403191 TTTTTTTTTTTCCCCTGAGACGG + Intergenic
959843413 3:111004553-111004575 TGTGTGATGTTCCCCTCCCAGGG - Intergenic
961475248 3:127141885-127141907 TGTTTGTAGTTCTCATGAGAAGG + Intergenic
963205754 3:142632601-142632623 TTTTTTTTTTTCCCCTGAGACGG + Intronic
963243233 3:143032075-143032097 TTTTTTTTTTTCCCCTGAGATGG + Intronic
964697121 3:159521732-159521754 AGTATGTTGTGCCCCTGAGTTGG + Intronic
966014144 3:175120471-175120493 TGTGTGTTGTTCCACTAAACTGG + Intronic
967109004 3:186276684-186276706 TGTGCTGTGTTCCCCTGGGATGG - Intronic
967482691 3:189992096-189992118 TGTTTGTTTTTCCTTTGAGATGG + Intronic
968037267 3:195558212-195558234 TGTTTTTTTTTTCCCTGAGATGG - Intergenic
968621783 4:1606738-1606760 TGTGTAGCGTTCCCCTGCGAGGG + Intergenic
969686308 4:8676288-8676310 GGTCTGTTGTTCCACAGAGAAGG - Intergenic
970112902 4:12658630-12658652 TGTGTGTTGGACCCCTGAGTTGG - Intergenic
970834739 4:20388767-20388789 TTTTTTTTTTTCCCCTGAGACGG - Intronic
971685663 4:29763560-29763582 TGTGAGTAGTTTCCTTGAGACGG + Intergenic
971740422 4:30512800-30512822 TGTGTCTTCTTCATCTGAGAGGG + Intergenic
971970325 4:33611199-33611221 GGTGTGTTGTTCCCCTGTATGGG - Intergenic
972511921 4:39774606-39774628 TTTCTTTTTTTCCCCTGAGACGG - Intronic
974186659 4:58456123-58456145 TGTGTCTTGTTTCCCTCTGAGGG + Intergenic
977433606 4:96965349-96965371 TTGGTGTTATTCCCCTGAGAAGG + Intergenic
979997892 4:127454448-127454470 TGTTTGTTTTTCCCCTCAGATGG - Intergenic
981806344 4:148719894-148719916 TTTGTGTTGCTCCCCTTAGAGGG - Intergenic
983051638 4:163054811-163054833 TGTGTGTTGTTCCCCTCACAGGG + Intergenic
983965454 4:173804122-173804144 TGTGTGTTGTTCCCCTGCCTGGG + Intergenic
984335239 4:178381231-178381253 TGTGTCTTTTGCCCATGAGATGG - Intergenic
984540822 4:181035073-181035095 TGTGTGTATTTCTCCTGAGTGGG + Intergenic
987320332 5:16762957-16762979 TTTTTTTTTTTCCCCTGAGACGG - Intronic
987514848 5:18892155-18892177 TGTGTGTTGTTCCCCTCTCTGGG - Intergenic
987553141 5:19409850-19409872 TGTGTGTTGTTCCCCTCTATGGG + Intergenic
988704357 5:33709669-33709691 TGTGTGTTGTTCCCCTCCCTGGG - Intronic
989837334 5:46008963-46008985 TGTGGGTTGTTCTCCTTAGGTGG + Intergenic
990167060 5:53006026-53006048 TGTGTGTTGTTCCCCTCCCGGGG - Intronic
993067523 5:83117952-83117974 TTTTTGTTGTTCCCCAGTGAAGG + Intronic
993463030 5:88208636-88208658 TGTTTTTTGTTTTCCTGAGACGG - Intronic
993905151 5:93614286-93614308 TGTGTATTGTTTTCCTTAGAAGG + Intergenic
994628220 5:102248520-102248542 TCTGTGTTGTTCCCTTGTGCAGG + Intronic
995357654 5:111257968-111257990 TGTGTGTTGTTCCCCTGAGATGG - Intronic
995958241 5:117806578-117806600 TGTTGTCTGTTCCCCTGAGAAGG + Intergenic
996471356 5:123864624-123864646 TGTGTGTTATTACCCAGAAATGG + Intergenic
998698413 5:144668075-144668097 TGTGTTTTATTCTCCTGACATGG - Intergenic
999522419 5:152364350-152364372 TGTGTGTTGTTCCCCTCCCTGGG - Intergenic
1000185859 5:158857252-158857274 TATGTGTTGTTCAGGTGAGAAGG - Intronic
1000923862 5:167170222-167170244 TGTACGTTTTTCCCCTGAGAGGG - Intergenic
1003002458 6:2348941-2348963 TGTGAGTTGTTACCGTGAGGAGG - Intergenic
1007592116 6:43028323-43028345 TGTTTGTTTTTCCTGTGAGATGG - Intronic
1008397035 6:51020903-51020925 TGTGTGTGTGTCCCCTGATAAGG - Intergenic
1009306659 6:62099459-62099481 GGTGTGTTGTTCCCTAGAGGAGG + Intronic
1009874572 6:69489563-69489585 TGTGTGTTGTTCCCCTCTTTGGG + Intergenic
1009958907 6:70495097-70495119 TGTGTTTTTTTCCCAAGAGATGG - Intronic
1010878260 6:81136511-81136533 TGTGTGATGTTCCCCTCCGTGGG - Intergenic
1011130718 6:84049418-84049440 TGTGTGTTTTTTTTCTGAGATGG - Intronic
1011776190 6:90733298-90733320 TGTGTGATGTTCCCCGCTGAGGG + Intergenic
1011851134 6:91630104-91630126 TGTGTGTTGTTCCCCTCCCTGGG + Intergenic
1012748198 6:103122174-103122196 TGTGTGTTGTTCCCCTCTATGGG - Intergenic
1013932211 6:115547275-115547297 TGTGTGTTTTTCACATAAGATGG - Intergenic
1014650886 6:124035857-124035879 TGTGTGGAGTTCCCCGGTGATGG + Intronic
1015840666 6:137473487-137473509 TGTGTTATGTTCCCATGAGCAGG - Intergenic
1015950414 6:138547385-138547407 TCTTTTTTTTTCCCCTGAGAGGG + Intronic
1016892673 6:149022257-149022279 TCTGTTTTGTTGTCCTGAGATGG + Intronic
1019275141 7:172276-172298 GGTGTGGTGTTCCACTGAGCAGG - Intergenic
1021254123 7:18368815-18368837 TCTCTGTGGTGCCCCTGAGAAGG + Intronic
1021550889 7:21869807-21869829 TGTATGATGTTTGCCTGAGAAGG - Intronic
1022313582 7:29221639-29221661 AGTGTGTTGTTCCCCACATATGG + Intronic
1023212301 7:37819849-37819871 TCTGTGGTGTTGCCTTGAGATGG - Intronic
1024251397 7:47508359-47508381 TGTGTGTTTTGCCCATCAGAAGG - Intronic
1024279467 7:47707453-47707475 TGTTTGTTTTTCTCTTGAGATGG - Intronic
1024854696 7:53764407-53764429 TGTGTGTTGTTCCCCCCAATAGG + Intergenic
1026364924 7:69638452-69638474 TGTATGTTTTTCCCTTGATATGG + Intronic
1027439335 7:78201712-78201734 TGAGTGTTTCTCCACTGAGATGG + Intronic
1029470255 7:100750044-100750066 TGTGTGTTGTTTTTTTGAGATGG - Intronic
1030119579 7:106095352-106095374 TTTTTTTTTTTCCCCTGAGATGG + Intronic
1031563371 7:123264818-123264840 TGTGTGTTGTTCCCCTCCCTGGG + Intergenic
1032200900 7:129822077-129822099 TGTGTGTTCTTTCAGTGAGAAGG - Intergenic
1035774517 8:2177956-2177978 TGTGGGTTGTTCCCCTCTGGAGG - Intergenic
1037799974 8:22027608-22027630 TTTTTTTTTTTCCCCTGAGATGG + Intronic
1037905586 8:22714186-22714208 TGTGTTTTCTCCCCCTGAGGAGG - Intronic
1038626444 8:29197928-29197950 TGAGTTTTGATCCTCTGAGAAGG - Intronic
1040515096 8:48128035-48128057 TATGTTTTTTTCCCCCGAGAGGG + Intergenic
1043541039 8:81262776-81262798 TGTATGTTGGGCCCATGAGAGGG + Intergenic
1043683357 8:83059579-83059601 TGTGTGTTTTCCCCCTGACTTGG + Intergenic
1045073015 8:98530338-98530360 TGTGTGTTGTTCCCCAGATGTGG + Intronic
1045092148 8:98756978-98757000 TTTGTGTGGTTTCCCTGGGAAGG - Intronic
1047689218 8:127333944-127333966 TGTTTGTTTTCCTCCTGAGACGG - Intergenic
1047895589 8:129363025-129363047 TGTCTGTACTTCCCCTGAGGAGG - Intergenic
1049149109 8:141022966-141022988 TGTCTGTTGTTTTCCTGAGAGGG - Intergenic
1050451870 9:5790182-5790204 TTTTTTTTTTTCCCCTGAGACGG + Intronic
1050492617 9:6204781-6204803 TGTGTGTTTTGCACGTGAGATGG - Intergenic
1050821602 9:9886475-9886497 TGTGTATTTTTCCCATGGGAGGG + Intronic
1050894094 9:10863858-10863880 AGTGTGGTGTTCCCTAGAGAAGG - Intergenic
1051663312 9:19445377-19445399 TGTGTGTTTATCCACTGACATGG - Intronic
1052677362 9:31644438-31644460 TGTGTGATGTTCCCCTCCCATGG + Intergenic
1053081087 9:35177282-35177304 TGTTTTTTGTTTCTCTGAGATGG - Intronic
1053505643 9:38641209-38641231 TGTGTGATGTTCCCAGGAGTGGG + Intergenic
1054980068 9:71195921-71195943 TGTGTGTTGTTCCCCTCTTTGGG - Intronic
1055608228 9:77993695-77993717 TTTTTTTTCTTCCCCTGAGATGG - Intronic
1055689250 9:78811644-78811666 TATGTGTTTTTCCCCTAAGGTGG + Intergenic
1056183476 9:84108249-84108271 TGTGTGTTGTTGCAATCAGAAGG + Intergenic
1058136711 9:101315875-101315897 TGTTTGTGGTTCCCATGAGGCGG + Intronic
1060177076 9:121505035-121505057 TTTTTTTTTTTCCCCTGAGATGG - Intergenic
1062265252 9:135683918-135683940 TGTGTGTTCTCTCCCCGAGAAGG - Intergenic
1062645725 9:137547225-137547247 TGTGTTTTGAGCCCCTGGGAGGG - Intronic
1203752106 Un_GL000218v1:89620-89642 TTTTTTTTTTTCCCCTGAGACGG + Intergenic
1186252026 X:7678464-7678486 TGTGTCTTGTTAGCTTGAGATGG + Intergenic
1186348657 X:8720729-8720751 TTTTTGTTTTTCCCCAGAGATGG - Intronic
1186669132 X:11751802-11751824 TGTATTTTGTTCCCCTGTCATGG + Intergenic
1188171955 X:26938559-26938581 TGTGTGTTGTTCCCCTCTATGGG - Intergenic
1189457512 X:41206779-41206801 TTTTTTTTTTTCCCCTGAGATGG + Intronic
1190514775 X:51212504-51212526 GGCGTTTTGTTTCCCTGAGATGG - Intergenic
1190935848 X:54998520-54998542 TGTTCGTTGGTTCCCTGAGAAGG + Intronic
1191675285 X:63786102-63786124 TGTGTTGTGTTCCCCAGAGTTGG - Intergenic
1191773793 X:64790198-64790220 TGAGTGTTGTTGCTTTGAGAAGG - Intergenic
1192133474 X:68574753-68574775 TGTGGCTTGTGGCCCTGAGAAGG - Intergenic
1192856153 X:75014397-75014419 TGTGTGTTGTTCCCCTCCCTGGG + Intergenic
1193131772 X:77927805-77927827 TGTGTGATGTTCCCCTTCGTGGG + Intronic
1193387761 X:80891506-80891528 TGTGTGTCCTGCACCTGAGATGG + Intergenic
1193622948 X:83778983-83779005 TGTGTGTTGTTGCTGTGAGATGG - Intergenic
1193932100 X:87565926-87565948 TGTGTGTTGTTCCCCTCAGTTGG - Intronic
1194832343 X:98639052-98639074 TGTGTGTGGTTCCTCAGGGATGG - Intergenic
1198211943 X:134524406-134524428 TGTGTGTTGTTCCCCTCCCTGGG + Intergenic
1201519080 Y:14852369-14852391 TTTTTTTTTTTCCCCTGAGATGG - Intergenic
1201897245 Y:19005088-19005110 TGTTTGTTTTTTCCTTGAGATGG - Intergenic