ID: 995357665

View in Genome Browser
Species Human (GRCh38)
Location 5:111257997-111258019
Sequence CCTAGCACGGGGAGGGTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995357654_995357665 6 Left 995357654 5:111257968-111257990 CCATCTCAGGGGAACAACACACA 0: 1
1: 0
2: 4
3: 25
4: 267
Right 995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG 0: 1
1: 0
2: 0
3: 4
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995357665 Original CRISPR CCTAGCACGGGGAGGGTGTC GGG Intronic
900605397 1:3521484-3521506 CCTGGGATGGGGAGGGTGTTGGG - Intronic
900898148 1:5498244-5498266 CCTAGCATGGGGAGGGAATGTGG - Intergenic
901881981 1:12199372-12199394 CCCAGCCCAGGGAGGGTGTGGGG + Intronic
904300338 1:29549872-29549894 CCTGGCACAGGGTTGGTGTCTGG + Intergenic
907860254 1:58345884-58345906 CCCAGGACGGGGAGGGAGGCAGG - Intronic
910206617 1:84754638-84754660 CCTACCGCGGCGATGGTGTCGGG - Intergenic
914425012 1:147567771-147567793 CCTAGCAGGGGGAGGGGGAAGGG - Intronic
917869484 1:179229227-179229249 CCCAGCATGGTGAGTGTGTCTGG - Exonic
918326675 1:183417500-183417522 CCTAGGACGGGGAGGGGGCCGGG - Intronic
1065419143 10:25522283-25522305 CCAAGCACTGGGAGGGTAACGGG - Intronic
1067249552 10:44575363-44575385 CCTGGGTCTGGGAGGGTGTCAGG + Intergenic
1071135295 10:82446628-82446650 CCTGTCACGGGGAGGGAGTACGG + Intronic
1074509798 10:114101642-114101664 CCTAGCCCTGTGTGGGTGTCGGG - Intergenic
1079332202 11:19542872-19542894 CCCAGGAAGGGGAGGGTTTCAGG - Intronic
1081614592 11:44583128-44583150 CCTAGCATTGGGAGGGAGTGGGG + Intronic
1083775668 11:64893361-64893383 CCTAGGACAGGGAGGGCGGCAGG + Intergenic
1084249181 11:67882775-67882797 ACTAGGATGGGGAGGGGGTCTGG + Intergenic
1085084330 11:73656649-73656671 CCTGGCATGGGGTGGGTGGCAGG + Intronic
1085318267 11:75559120-75559142 CCTGGCACGTGGAGGCTGGCTGG - Intergenic
1089494033 11:118899547-118899569 CCCAGCTCGGGGAGGGTGCAGGG + Intronic
1095900687 12:47325239-47325261 CCTACAACGGGGAGGGGGTGGGG - Intergenic
1106790931 13:33154144-33154166 CCATCCACAGGGAGGGTGTCGGG + Intronic
1116596587 14:46856460-46856482 TCTAGCAAAGGGAGGGTGGCTGG - Intronic
1121820523 14:96962181-96962203 CCCAGCCCTGGGAGGGTGTTAGG - Intergenic
1129148549 15:73671779-73671801 CACAGCACGGGGAGGGTGAAAGG - Intergenic
1131021038 15:89099035-89099057 CCTGGCACAGGGAGGGTCCCTGG + Intronic
1132980908 16:2738272-2738294 CCCAGCACGGGGATGGAGGCTGG + Intergenic
1133420058 16:5638394-5638416 CCTAGCAGGGGGAGGGCTTCTGG + Intergenic
1136398488 16:30005476-30005498 GCTGGCACGGGGAGGGCGCCGGG - Exonic
1136911387 16:34147173-34147195 CCCAGCCAGGGGAGGGTGGCGGG - Intergenic
1137439358 16:48484815-48484837 CCCAGTACCTGGAGGGTGTCAGG + Intergenic
1138528097 16:57620373-57620395 CCTAGCACCGGGAAGCTGGCAGG + Intronic
1140055824 16:71524784-71524806 CCTAGCACGGGAAAGATGGCAGG + Intronic
1140902653 16:79384100-79384122 CCTAGAACAGGAAGGGAGTCAGG + Intergenic
1142951425 17:3484271-3484293 CCTAGCACAGGGTTGGTCTCTGG - Intronic
1144959353 17:19036129-19036151 CCTGGCACGGGGTGGGAGGCTGG - Intronic
1144975806 17:19138395-19138417 CCTGGCACGGGGTGGGAGGCTGG + Intronic
1150483439 17:65528102-65528124 CCCAGAATGGGGAGGGTGCCTGG + Intergenic
1152917701 17:83050710-83050732 CGGAGCACGGGGAAGGTGTTCGG + Intronic
1153968180 18:10200875-10200897 TCCAGCATGGGGAGGGTGTGTGG + Intergenic
1156223335 18:35076560-35076582 CCTAGCCTGGGGAGTCTGTCAGG - Intronic
1158106891 18:53895542-53895564 CCTAGACCTGGGAGGGGGTCCGG - Intergenic
1158343826 18:56494428-56494450 CCTGGCACGGGGAGGGTCGAAGG + Intergenic
1161166776 19:2791928-2791950 CCTGGCTGGGGGAGGGTGCCAGG - Intronic
1161427209 19:4210180-4210202 CCAGGCACGGGGAGGGGCTCTGG + Intronic
1161694439 19:5758150-5758172 CCCAGCCCGGGGAGGGTAGCCGG + Intronic
1161871960 19:6877118-6877140 CCTACCACAGGCAGGGTATCGGG - Intergenic
1162583694 19:11546283-11546305 CCCAGCAGGAGGAGGGTGACGGG - Intronic
1163378209 19:16947264-16947286 CCAGGCACTGGGAGGGGGTCTGG - Intronic
1163715609 19:18870509-18870531 CCAAGGACGGGGAGCGTGGCCGG + Exonic
1165020649 19:32921444-32921466 GCCAGCATGGGGAGAGTGTCAGG - Intronic
1166354232 19:42217529-42217551 CCTTGCAGGGCGAGGGGGTCGGG - Intronic
1167748880 19:51368216-51368238 ACCAGGACGGGGAGGGGGTCGGG + Intronic
1168401502 19:56088248-56088270 CCCAGCACGGGGACGGGCTCGGG - Exonic
934737768 2:96698649-96698671 CCTGGCGGGGGGAGGGTGTTGGG - Intergenic
935325771 2:101935583-101935605 CCTAGCCAAGGGAGGGTGTGAGG + Intergenic
936349760 2:111703779-111703801 CCTGGCACAGGGAAGGTGCCGGG - Intergenic
937342339 2:121099228-121099250 CCTAGCAGCTGGATGGTGTCAGG + Intergenic
945989170 2:216379293-216379315 CCTATCACTGGGAGGGTCTAGGG - Intergenic
946623949 2:221591148-221591170 ATTAGCATGGGGAGGGAGTCTGG - Intergenic
1169257572 20:4110795-4110817 CCAAGCACGGGAAGTCTGTCTGG - Intergenic
1169430438 20:5531521-5531543 CTCAGCACAGGGAGGGTGCCAGG + Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1172176542 20:32975944-32975966 CCTAGAACGGGTAGTGTCTCAGG + Intergenic
1172502469 20:35437169-35437191 TCTGGCCCGGGGTGGGTGTCTGG - Intronic
1175199156 20:57266285-57266307 CCGAGCAGGGGGCGGGGGTCCGG - Exonic
1176172613 20:63702822-63702844 CCTCGCACAGGGAGGGAGTGTGG + Intronic
1177691760 21:24519178-24519200 CCTATCACGGGGATGGAGTAGGG + Intergenic
1178608209 21:34057551-34057573 CCTACCCCAGGGAGGGGGTCTGG - Intergenic
1179435503 21:41359610-41359632 CCTGTCACGGGGCGGGTGTGAGG - Intergenic
1180974856 22:19842711-19842733 CCTTGCCCAGGGAGGGTTTCTGG - Intronic
1181465437 22:23108219-23108241 CCCAGCACGGGGTGGATGGCAGG - Intronic
1182331720 22:29555713-29555735 TCTAGCAGGGGGAGGGAGGCAGG + Exonic
1182862438 22:33571642-33571664 CCTAGCACGTGCTGGGTGTCAGG + Intronic
1183270141 22:36856912-36856934 CCTAGCACACAGTGGGTGTCTGG + Intergenic
1183653827 22:39173862-39173884 CCTGGAACAGGGAGGGTGTAGGG - Intergenic
1184608681 22:45588914-45588936 GCCAGCACCGGGAGGATGTCAGG + Intronic
952254336 3:31682439-31682461 CCTGGCACGGGGATGGAGACAGG - Intronic
961289944 3:125838619-125838641 AGTAGGACGGGGAGGGGGTCTGG - Intergenic
961657443 3:128451124-128451146 CCTCGCTCGGTGATGGTGTCTGG + Intergenic
965827841 3:172748746-172748768 CCTAGCAGAGGGCTGGTGTCTGG - Intergenic
968903739 4:3442550-3442572 CCGAGGGCGGGGAAGGTGTCAGG + Intronic
969075867 4:4577250-4577272 CCTAGCATGGGGAGGAGGTGGGG - Intergenic
974077909 4:57184481-57184503 CCCTGCACGGGGAGGGTCTCGGG + Intergenic
979359081 4:119740683-119740705 CCTAGCACTTGGAGGGGGTGAGG - Intergenic
980260038 4:130436971-130436993 CCTGGCAGGGGGAGGGGGGCTGG - Intergenic
980463814 4:133149915-133149937 CTTAGCACAGGAAGGGTGACAGG - Exonic
982281015 4:153684017-153684039 CCTTGCACGGGGCAGCTGTCGGG + Intergenic
985002479 4:185499816-185499838 CCTAGCAGGGGGAGCCTGTTGGG + Intergenic
985695158 5:1335948-1335970 TCCAGCACGTGGAGGGTGGCGGG - Intronic
989600048 5:43192452-43192474 CCTAGCAGAGGAAGGGTGGCGGG - Intronic
991057083 5:62333400-62333422 GCTTGTACTGGGAGGGTGTCAGG + Intronic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
1003292265 6:4789483-4789505 CCTAGGGCGGGGAGGCTGCCAGG - Intronic
1004218469 6:13724246-13724268 ACTAGCACGGGGAGGAAGCCAGG + Intergenic
1005931817 6:30490115-30490137 CCTAGACCGGGGAGAGTCTCAGG + Intronic
1008876317 6:56333292-56333314 CCTAGGAAGGGGAGGGTGGGAGG - Intronic
1016974204 6:149791033-149791055 CTTAGCATGGAGAGGGGGTCAGG + Intronic
1020327840 7:6989076-6989098 ACTAGGATGGGGAGGGGGTCTGG + Intergenic
1021909958 7:25375580-25375602 CCTTGCACAGGGAGGGAGCCGGG + Intergenic
1029270228 7:99373205-99373227 CCTCCAATGGGGAGGGTGTCGGG + Intronic
1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG + Intronic
1031970060 7:128058120-128058142 CCTAGCACTGGCAAGGGGTCAGG - Intronic
1032182467 7:129692093-129692115 CCTGCCACCGGGAGGGTGGCAGG - Intronic
1033451034 7:141462584-141462606 CCAAGCAGGAGGAAGGTGTCAGG + Intronic
1043975466 8:86580183-86580205 AATAGCACGGGGGGGGTGGCGGG + Intronic
1049016527 8:139924017-139924039 CCGAGCACGGGGAGGGGGCATGG + Intronic
1049438637 8:142599151-142599173 CCTGGCATGGGGAGGCTGTGTGG + Intergenic
1052995618 9:34550380-34550402 CCTGCCACGGGGAGTGTATCAGG + Intergenic
1053480739 9:38414625-38414647 CCTTCCACGTGGAGGGTGTTAGG + Intronic
1061924501 9:133799316-133799338 CGCAGCGCTGGGAGGGTGTCAGG - Intronic
1061940841 9:133883012-133883034 CCTGGCATGGGGTGGGTGTGGGG - Intronic
1062266110 9:135687287-135687309 CCTTCCACTGGGAGGGTGTGGGG - Intergenic