ID: 995359634

View in Genome Browser
Species Human (GRCh38)
Location 5:111280673-111280695
Sequence CCGTGTAAATCTCTGAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995359632_995359634 9 Left 995359632 5:111280641-111280663 CCAAACTGAAAGGTTTGCTGAGA 0: 1
1: 0
2: 6
3: 23
4: 322
Right 995359634 5:111280673-111280695 CCGTGTAAATCTCTGAGATGTGG 0: 1
1: 0
2: 0
3: 7
4: 105
995359631_995359634 18 Left 995359631 5:111280632-111280654 CCTAGATCTCCAAACTGAAAGGT 0: 1
1: 0
2: 0
3: 15
4: 166
Right 995359634 5:111280673-111280695 CCGTGTAAATCTCTGAGATGTGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995359634 Original CRISPR CCGTGTAAATCTCTGAGATG TGG Intronic
900763984 1:4491645-4491667 TCGTGTCATTATCTGAGATGGGG - Intergenic
901235885 1:7667429-7667451 ACGTGTAAATGGCTGAGAGGGGG + Intronic
907337727 1:53711179-53711201 CCCTGTAAACCCCAGAGATGAGG + Intronic
907411228 1:54284956-54284978 CGGTGTAATTCTCTGAAATGTGG + Intronic
907652879 1:56312487-56312509 CCGAGTAAATCTCTGTTGTGTGG - Intergenic
907808168 1:57841790-57841812 CTGTGAAGATCTCTGAAATGGGG + Intronic
912579419 1:110706540-110706562 CCATGTAACTCTCTTAGAAGGGG + Intergenic
913092125 1:115483495-115483517 CCTTGTACTTCTGTGAGATGGGG + Intergenic
914746294 1:150504045-150504067 TGGTGAAGATCTCTGAGATGAGG + Intronic
918920153 1:190698558-190698580 CCTAGTAAATCTGTGAGAAGAGG + Intergenic
923413343 1:233731376-233731398 CCTTCTCAATCTGTGAGATGGGG - Intergenic
1064800693 10:19067432-19067454 ACGTGTAAACCTATCAGATGAGG - Intronic
1068257539 10:54532866-54532888 GCATGTACATCTTTGAGATGTGG - Intronic
1068921497 10:62489441-62489463 CCCTGCAAAGCTCTGAGAAGAGG + Intronic
1069914195 10:71777296-71777318 CCTCGTAAAGCTCTGAGCTGGGG + Intronic
1070685968 10:78481402-78481424 CCTTGAAAATCTCAGAGATGGGG - Intergenic
1071083249 10:81838246-81838268 CCTTGTAAATTTCTGAGCTCAGG - Intergenic
1075902658 10:126055524-126055546 AAGTGAAAATCTCTGAAATGGGG - Intronic
1076470167 10:130713222-130713244 CCTGGAAAATCTCTGAGAGGAGG - Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1082701596 11:56438655-56438677 ACGTGCACATCTCTGGGATGTGG + Intergenic
1085525754 11:77162571-77162593 CAGTGTATATCTCAGAGTTGGGG + Intronic
1095213946 12:39526786-39526808 CCTAGTAAAGCTCTGAGAAGAGG - Intergenic
1097835348 12:64267453-64267475 CCTAGAAAATCTCTGACATGTGG + Intronic
1097835357 12:64267505-64267527 CCTAGAAAATCTCTGACATGTGG + Intronic
1101282794 12:103276685-103276707 TCTTGTAAACCTCTGAGATTTGG + Intronic
1109886125 13:68547544-68547566 ACGTGTACATCTTTGGGATGTGG - Intergenic
1113597424 13:111543528-111543550 CCCTGTTAAGCTCTGTGATGGGG - Intergenic
1117818816 14:59626947-59626969 CTGTGAAAATATCTCAGATGAGG + Intronic
1121907025 14:97755555-97755577 CCATGTAAATATCTGAGAGGAGG + Intronic
1123457379 15:20438628-20438650 CCGTGCAGTTCTCTGACATGCGG - Intergenic
1123660679 15:22561731-22561753 CCGTGCAGTTCTCTGACATGCGG + Intergenic
1124263529 15:28213778-28213800 CCGTGCAGTTCTCTGACATGCGG - Exonic
1124314479 15:28655968-28655990 CCGTGCAGTTCTCTGACATGCGG + Intergenic
1126369411 15:47929640-47929662 CCCTGTTAAACTCTGAGATGTGG + Intergenic
1129908745 15:79208709-79208731 CCGAATAAATCACTGAGATTTGG + Intergenic
1130446704 15:84008846-84008868 CCTTGTCATTCACTGAGATGAGG - Intronic
1134033663 16:11013066-11013088 ACATGTACATCTCTGGGATGAGG + Intronic
1134470529 16:14521371-14521393 CCCGGCAAATCTCTGACATGTGG + Intronic
1135181824 16:20281510-20281532 CAGTGCAAAGCTCTGAGATGGGG + Intergenic
1136701882 16:32152150-32152172 CCGTGCAGTTCTCTGACATGCGG - Intergenic
1136765782 16:32775310-32775332 CCGTGCAGTTCTCTGACATGCGG + Intergenic
1136802316 16:33095068-33095090 CCGTGCAGTTCTCTGACATGCGG - Intergenic
1141023101 16:80516409-80516431 CCTTGTAAACCTATGAGAAGTGG - Intergenic
1141479221 16:84295112-84295134 CCGTGTAAGTGCCTGGGATGGGG + Exonic
1203068171 16_KI270728v1_random:1037558-1037580 CCGTGCAGTTCTCTGACATGCGG + Intergenic
1148882535 17:50740936-50740958 CTGTGTAAAGCTCTATGATGAGG + Intronic
1150209375 17:63433831-63433853 CCCTGGGAAGCTCTGAGATGAGG - Exonic
1150845968 17:68658258-68658280 CCCTGAAAATCTCTGAGTTATGG + Intergenic
1156061812 18:33086642-33086664 CAGTTTAAATCTCTAAGAAGGGG + Intronic
1157327888 18:46682030-46682052 TGGTGTACTTCTCTGAGATGGGG + Exonic
1158099786 18:53818213-53818235 TGGTGTAAATCTCTGAGAGCAGG + Intergenic
1160163529 18:76492210-76492232 CCGTGTAAATGTTGGAGACGCGG - Intronic
1161652112 19:5491820-5491842 CTGTGTTACTCTCTGAGGTGGGG - Intergenic
1163126211 19:15245610-15245632 TAGTGTAAATCTCTGGGGTGAGG - Intronic
929321909 2:40554394-40554416 CCCTTTGAATCTCTGAGAAGTGG + Intronic
931895404 2:66723544-66723566 ACATGCACATCTCTGAGATGTGG - Intergenic
932187323 2:69709613-69709635 CCATGTAGATTTCTGGGATGTGG - Intronic
935804514 2:106732680-106732702 CCGTGTGAAGCTGTGTGATGGGG + Intergenic
937018488 2:118629100-118629122 CCTTGTAAACCACTGAGATATGG + Intergenic
939820819 2:146954965-146954987 CTATGGAAATCTCTGAGCTGGGG - Intergenic
941664825 2:168234230-168234252 CCATGTAACTTTCTGTGATGAGG + Intronic
942348697 2:175030514-175030536 CTGGGTACATCTCTGAGTTGTGG + Intergenic
943304417 2:186241936-186241958 CAGTGAAAATCGCTGACATGAGG - Intergenic
944497336 2:200321086-200321108 CAGTGACAATCTCTGAGAGGTGG - Intronic
945383701 2:209171950-209171972 CTTTGTATATCTCTGAGATCAGG - Intergenic
946242151 2:218362954-218362976 GCGTGAAAAGCACTGAGATGGGG + Intronic
948564319 2:238873998-238874020 CTCTGTACCTCTCTGAGATGGGG + Intronic
1170110252 20:12797234-12797256 CCATGTCAATCTCTGAAATGAGG - Intergenic
1170361095 20:15547248-15547270 CAGTGGAAATTTGTGAGATGAGG - Intronic
1172794251 20:37526291-37526313 ACGTTTAAATCTCTGAGGGGGGG - Intronic
950190780 3:10974776-10974798 CCGTGCAAAGCTCTGAGAGGAGG + Intergenic
950657937 3:14448912-14448934 CCCTGGAAATAACTGAGATGAGG + Intronic
951375655 3:21912910-21912932 CCGTTTCAATTTCTTAGATGTGG - Intronic
956004860 3:64767910-64767932 CCTCCTAACTCTCTGAGATGTGG + Intergenic
958564108 3:95785741-95785763 CAGTGTAAATCTCAGTGATAAGG - Intergenic
959963012 3:112322034-112322056 CCGTGTACATGTCTGAAAAGGGG - Intergenic
961020547 3:123502853-123502875 CTGTGTACATCCCAGAGATGAGG + Intronic
961683994 3:128617262-128617284 CCTTGTAAATCTCAGGGAGGAGG - Intergenic
963359938 3:144258660-144258682 TCTTGTGTATCTCTGAGATGAGG - Intergenic
972056444 4:34808432-34808454 GCATGGAAATGTCTGAGATGAGG - Intergenic
975256219 4:72238312-72238334 TCTTGTAAATCACAGAGATGTGG + Intergenic
975610614 4:76199100-76199122 CAGTGTAAAACTCAGAGATAAGG - Intronic
978021933 4:103824940-103824962 TCCAGTAAAGCTCTGAGATGAGG + Intergenic
980026848 4:127778309-127778331 CCGTGTACATGTCTGAAAAGGGG - Intergenic
983517567 4:168673806-168673828 CGGTGCCAATCTCTGAAATGAGG + Intronic
984754442 4:183312829-183312851 CCTTGTCAGGCTCTGAGATGTGG + Intronic
985870820 5:2555017-2555039 CAGTGTGAATCTGTGGGATGAGG - Intergenic
991315895 5:65305944-65305966 CCGGGTAATTTTCAGAGATGAGG + Intronic
993030545 5:82700471-82700493 GAGTGTCAATCCCTGAGATGGGG + Intergenic
995359634 5:111280673-111280695 CCGTGTAAATCTCTGAGATGTGG + Intronic
998037851 5:138931956-138931978 GCCTCTAAAACTCTGAGATGTGG + Intronic
1002047660 5:176550845-176550867 CCGTGGACTGCTCTGAGATGCGG + Intronic
1013910412 6:115269817-115269839 CCAGGTGATTCTCTGAGATGGGG - Intergenic
1021360415 7:19706205-19706227 CCGAGTAAGTCTCTGAGTTAGGG - Intronic
1025523401 7:61771486-61771508 AGGTTTAACTCTCTGAGATGAGG + Intergenic
1028258201 7:88627120-88627142 CCGTGTACATCTTTAGGATGTGG + Intergenic
1029375716 7:100176012-100176034 CTGAGTAACTCTCAGAGATGGGG + Intronic
1029884558 7:103854594-103854616 CCTTGTGACTTTCTGAGATGAGG + Intronic
1031198690 7:118649736-118649758 CCTCTTAAATCTCTGGGATGTGG - Intergenic
1041776561 8:61529284-61529306 CCCAGTAAATCTCTGAGACCAGG - Intronic
1048803713 8:138219529-138219551 CTGCGTAAATATTTGAGATGGGG + Intronic
1057305831 9:93911448-93911470 CCGTGTAAATCACTGTCATCCGG - Intergenic
1057890405 9:98865584-98865606 CCTTGGAAGTCTGTGAGATGGGG - Intergenic
1187052220 X:15706324-15706346 CCTTGTCAATCACAGAGATGGGG - Intronic
1187494622 X:19784314-19784336 CCGTGTATATCTAGGAAATGTGG + Intronic
1187967978 X:24631626-24631648 CTGTGTACATCTTTGGGATGTGG - Intronic
1194620516 X:96165143-96165165 CCCTGAAAATCACTGATATGAGG - Intergenic
1197168233 X:123402923-123402945 CCTTCTAAGTCTCTGGGATGAGG - Intronic
1197673444 X:129303785-129303807 CCATGGAAATACCTGAGATGGGG - Intergenic