ID: 995364598

View in Genome Browser
Species Human (GRCh38)
Location 5:111343781-111343803
Sequence TTGTATAGGGATAAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995364591_995364598 15 Left 995364591 5:111343743-111343765 CCAGAGCCTTCTCAATGCAGTAG 0: 1
1: 0
2: 2
3: 11
4: 162
Right 995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG No data
995364594_995364598 -9 Left 995364594 5:111343767-111343789 CCTAGTTATGTTACTTGTATAGG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG No data
995364592_995364598 9 Left 995364592 5:111343749-111343771 CCTTCTCAATGCAGTAGCCCTAG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG No data
995364593_995364598 -8 Left 995364593 5:111343766-111343788 CCCTAGTTATGTTACTTGTATAG 0: 1
1: 0
2: 1
3: 17
4: 167
Right 995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG No data
995364590_995364598 26 Left 995364590 5:111343732-111343754 CCTGATTTATTCCAGAGCCTTCT 0: 1
1: 0
2: 1
3: 17
4: 279
Right 995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995364598 Original CRISPR TTGTATAGGGATAAGGCAGA AGG Intronic
No off target data available for this crispr