ID: 995376632

View in Genome Browser
Species Human (GRCh38)
Location 5:111481443-111481465
Sequence TGTTTGGGCTAGATTTGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995376632_995376635 -3 Left 995376632 5:111481443-111481465 CCACTACAAATCTAGCCCAAACA 0: 1
1: 0
2: 0
3: 6
4: 110
Right 995376635 5:111481463-111481485 ACACACATTCTTTTGCAGAAAGG 0: 1
1: 0
2: 3
3: 26
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995376632 Original CRISPR TGTTTGGGCTAGATTTGTAG TGG (reversed) Intronic
902464997 1:16611915-16611937 AGTCTGGGGTATATTTGTAGGGG - Intronic
903406133 1:23097898-23097920 TGGCTGGGCTGAATTTGTAGAGG + Intronic
904346177 1:29871468-29871490 TGTTTGTTCTAGATGGGTAGTGG - Intergenic
907104986 1:51874646-51874668 TGGTTGGGCAGGATTAGTAGTGG - Intronic
916183344 1:162106900-162106922 TCTTTGGGATAGATTCCTAGAGG - Intronic
921914585 1:220593571-220593593 TCTGTGGGTTAGATTTGCAGAGG - Intronic
923301946 1:232649502-232649524 TCTTTGGGGTATAGTTGTAGAGG - Intergenic
1065834250 10:29642510-29642532 TGTCTAGGAGAGATTTGTAGGGG - Intronic
1066088432 10:31994037-31994059 TGGTTGGCCTGGCTTTGTAGTGG + Intergenic
1066661163 10:37739188-37739210 TGTTTGGGCTGGGATTGGAGTGG + Intergenic
1067813052 10:49445961-49445983 TGTTTGAGCTGGATTCTTAGTGG + Intergenic
1068654237 10:59558409-59558431 TGTTTGGGCTGTATTTGTTGTGG + Intergenic
1070300868 10:75202638-75202660 AGTTTGGTCTAGATATGGAGAGG - Intergenic
1070442007 10:76455722-76455744 TGTCTGGCATAGATGTGTAGGGG + Intronic
1073082776 10:100870504-100870526 TGTTTACGATATATTTGTAGGGG + Intergenic
1074292943 10:112154544-112154566 TGTTTGAGCTACCTTTGTGGTGG - Intronic
1074485643 10:113875454-113875476 TTCTTGGGCTAGAGTTGCAGTGG + Intronic
1078049193 11:7946779-7946801 TGTTTTGGCTATCTTTGTGGGGG + Intergenic
1078644921 11:13132329-13132351 TGTTTGGGCTATAATTGAAGAGG - Intergenic
1081404322 11:42679009-42679031 TGTTTGGACTAGAGTGGTAGTGG - Intergenic
1087077991 11:94143314-94143336 TGTTTGCTCTAGTATTGTAGAGG + Intronic
1088652165 11:111967480-111967502 GGTTTGGGCTAGAGTGGAAGAGG - Intronic
1089206636 11:116769724-116769746 AGCTTAGGGTAGATTTGTAGGGG - Intronic
1100936526 12:99675654-99675676 TTTTTGGGTTAGATTGGTAGAGG - Intronic
1100992436 12:100266141-100266163 TGTTTTTTCTAGATTTGCAGGGG + Intronic
1102091552 12:110193542-110193564 TGTCTGATCTGGATTTGTAGAGG - Intronic
1104820713 12:131675774-131675796 GGTGTGGGCTGGATTTGCAGGGG + Intergenic
1106711179 13:32334985-32335007 AGTTTGGGTTAAATTTTTAGAGG + Intronic
1109142797 13:58736185-58736207 TGAGTGGGCTAGATTTCTGGAGG - Intergenic
1111777153 13:92678842-92678864 GATTTGAGCTAGAGTTGTAGTGG + Intronic
1114205945 14:20571338-20571360 TGTTTTGGCTGGATTTGTCAGGG + Intergenic
1114491000 14:23101941-23101963 TGTTTGGGCTTCATTTGCTGAGG - Intergenic
1114548003 14:23516352-23516374 TGTTTGGGATATGTTTGTTGTGG + Intergenic
1118782509 14:69018153-69018175 AGTTTGGGCTAGATGTGGTGAGG + Intergenic
1121438724 14:93935490-93935512 TGCTTGGGCCAGATATGCAGAGG + Intronic
1122510928 14:102266968-102266990 TGTTTTGGCATGATTTGTATTGG - Intronic
1124504568 15:30261874-30261896 TGTTTGGGACAGATTGGAAGAGG - Intergenic
1124738984 15:32276761-32276783 TGTTTGGGACAGATTGGAAGAGG + Intergenic
1128197556 15:65773769-65773791 AGTTTTGGCCAGATTTGTGGAGG - Intronic
1128845386 15:70890277-70890299 TGTTTGGGCAAAGTTTGTATAGG + Intronic
1144790968 17:17859025-17859047 TGGTTGGATTTGATTTGTAGAGG + Intronic
1145393060 17:22470855-22470877 TGTTTGTGCTACATTTCTGGAGG - Intergenic
1147303310 17:39546774-39546796 TGTTTGGGGTTGATGGGTAGGGG - Intronic
1149364297 17:55925776-55925798 TGTTTAGGCTTGATTTCCAGAGG + Intergenic
1153928956 18:9861278-9861300 TCTTTGGGCTGGGTTTGCAGTGG + Exonic
1154490034 18:14914558-14914580 TGTTTGGGCAAGAATTGTGGTGG + Intergenic
1159203931 18:65225792-65225814 TGTCTGGGCTAGATATGATGAGG + Intergenic
1159529186 18:69634103-69634125 TGTTTGGACTAATTTTTTAGAGG - Intronic
1160135762 18:76270204-76270226 TGTTGGGGGTGGATTTGAAGGGG - Intergenic
1162545873 19:11329248-11329270 TGTTGGGGTTAGGTTTGTAGGGG + Intronic
1163174654 19:15555929-15555951 GGGTTGGGCTAGAGTTGGAGCGG + Intergenic
1164258798 19:23551670-23551692 GCTTTGGGCTAGAATTCTAGGGG - Intronic
1165940872 19:39414113-39414135 GGCTTGGGCTAGGTTTGGAGAGG - Exonic
932025881 2:68132118-68132140 TATTTGGTCTAGATTTGAAAAGG + Intronic
932888485 2:75569632-75569654 TGGTTGGGAGAGATATGTAGCGG - Exonic
933348439 2:81121385-81121407 TCTTTGGGGTAAATTTGAAGTGG + Intergenic
935892888 2:107699243-107699265 TGTTTGGTCTAAATTTTAAGGGG - Intergenic
936076529 2:109405023-109405045 TGTAGGGGCTAGAGATGTAGGGG - Intronic
938774633 2:134530623-134530645 TGGTTTGGGTAGATTTGTTGAGG - Intronic
938811638 2:134859065-134859087 TCTTTGGCCTAGAGTTGAAGGGG - Intronic
939084148 2:137697019-137697041 TGTTTTGGAAAGATCTGTAGTGG + Intergenic
940458915 2:153937687-153937709 TGCTTGGTCTATAGTTGTAGTGG + Intronic
941766069 2:169298004-169298026 TGTCTGGGCTGGACTTGTATCGG - Intronic
942208960 2:173651462-173651484 TCTGTGGGCTAGATTTCTGGGGG - Intergenic
943036341 2:182750630-182750652 TGTATAGCCTAGATGTGTAGTGG - Intronic
1170359026 20:15524234-15524256 TGCTTGGGGTAGATTTGTGAGGG + Intronic
1170652728 20:18257412-18257434 TGTGTGGGCTGGGTTTGAAGGGG + Intergenic
1175956389 20:62611784-62611806 TGTTTGGCCTAGGTTTGCACTGG - Intergenic
1176972944 21:15287978-15288000 GGTTTGGGATAGACTTGTGGTGG - Intergenic
1177639700 21:23830861-23830883 TGTTTGGGTAACATTTGTAAGGG + Intergenic
1177701190 21:24641412-24641434 TGTTTGGGTTATATTGTTAGGGG + Intergenic
1178372334 21:32036842-32036864 TCTTTGGGGTATATGTGTAGGGG - Intronic
959309782 3:104719692-104719714 TGTTTGGGATTCATTTGTACAGG + Intergenic
963076926 3:141355670-141355692 TGTTTGGGCTAGAGATTTACAGG - Intronic
967605147 3:191436118-191436140 TTTTTGGCCTAGTTTTTTAGTGG + Intergenic
969834118 4:9825293-9825315 TGTTTGGAATAGATATGTTGAGG - Intronic
970939033 4:21609564-21609586 TGCTAGGACTAGATTTGAAGGGG + Intronic
979311512 4:119209529-119209551 TGTGTGGGCTAAAGTTGGAGAGG - Intronic
980669184 4:135981688-135981710 TTTTTGTGCTATACTTGTAGAGG - Intergenic
981593492 4:146391881-146391903 TGTTTAGGGTAATTTTGTAGGGG - Intronic
981934744 4:150227618-150227640 CGTTGGGGCCAGATTTATAGAGG + Intronic
983484026 4:168312361-168312383 AGTCTGGACTAGATTTGAAGAGG + Intronic
983584777 4:169343088-169343110 AATTTGGGCAAGATTTGCAGTGG - Intergenic
985802202 5:2012026-2012048 TGTTTGTGCTAGATGTCTGGAGG + Intergenic
986583805 5:9293791-9293813 TGTTTAGGCTAGAGGTGGAGGGG + Intronic
987812004 5:22849115-22849137 TCTCTAAGCTAGATTTGTAGAGG - Intronic
990973855 5:61540116-61540138 TGTTAGGGTTAAATTTTTAGAGG + Intronic
994700317 5:103125009-103125031 TGTTAAGGCAAGTTTTGTAGAGG + Intronic
995376632 5:111481443-111481465 TGTTTGGGCTAGATTTGTAGTGG - Intronic
996842627 5:127864491-127864513 TTTCTGTGCTAGATTTGTAATGG + Intergenic
997819459 5:137051279-137051301 TGTTTGGGAAAGATTTTTTGAGG - Intronic
998557475 5:143139609-143139631 AGTTGGTGCTAGATTTGGAGGGG - Intronic
1000536785 5:162488309-162488331 TTTTGGGGCTACATTTGTTGGGG - Intergenic
1002624767 5:180518105-180518127 TGTTTTGGCTTGATTTTTTGAGG + Intronic
1002656502 5:180753034-180753056 TGTTTTGGCTGTCTTTGTAGAGG - Intergenic
1003913252 6:10761753-10761775 TGTTTTGGCTAGATGTGCAATGG + Intronic
1011468231 6:87680873-87680895 TTATTGGGCTAGATTTCTAAAGG - Intronic
1013017097 6:106169778-106169800 TGGTGGGGCTAGATGTGTAAAGG + Intergenic
1013555590 6:111253942-111253964 TGATTAGGCTAGATTTGTGTAGG - Intergenic
1015879599 6:137857862-137857884 TGTTTTGGTTGGATTTGAAGAGG + Intergenic
1017025484 6:150177355-150177377 TGTTGGGGCCAGATTTATATTGG + Intronic
1035300259 7:157892767-157892789 TATTTGGAGTAGATTTGCAGTGG - Intronic
1044232165 8:89791269-89791291 TGTTTGGGCTAAATTTGATATGG - Intergenic
1046446105 8:114321776-114321798 TGTTCAGGTTAGATTTGGAGAGG + Intergenic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1051918831 9:22239597-22239619 TGTTTGGGCTTGAATTTTATTGG + Intergenic
1052686510 9:31764424-31764446 TGTGTGGGCTAGAGTGATAGTGG + Intergenic
1052695291 9:31869803-31869825 TCTTGGGGCTAGGATTGTAGGGG + Intergenic
1053192340 9:36082940-36082962 TTTCTGTGTTAGATTTGTAGAGG - Intronic
1059019120 9:110554337-110554359 TCTTTGGGATAGATTCCTAGAGG - Intronic
1059816747 9:117924957-117924979 TTTTTGGGCAAGAGTTGTACAGG + Intergenic
1188749434 X:33886482-33886504 TGTTTGAGTTAGATTTAAAGAGG + Intergenic
1194176995 X:90662903-90662925 TTTTTGGGCTAGAATTCTAAAGG - Intergenic
1195123831 X:101785095-101785117 TGTTTGGGATTGTTTTGGAGGGG - Intergenic
1196209835 X:112983172-112983194 AGTATGTGCTAGAATTGTAGAGG + Intergenic
1199103243 X:143831439-143831461 TGTTTAGGATATACTTGTAGTGG + Intergenic
1199165675 X:144672443-144672465 TGTTTGGACTAAATTTCTAAGGG - Intergenic