ID: 995381775

View in Genome Browser
Species Human (GRCh38)
Location 5:111543331-111543353
Sequence ACAGAGGACATACATAGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995381772_995381775 -7 Left 995381772 5:111543315-111543337 CCTGATGAGCAGGAACACAGAGG No data
Right 995381775 5:111543331-111543353 ACAGAGGACATACATAGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995381775 Original CRISPR ACAGAGGACATACATAGATA GGG Intergenic
No off target data available for this crispr