ID: 995385563

View in Genome Browser
Species Human (GRCh38)
Location 5:111585092-111585114
Sequence CTGTGAGAATGCAGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995385558_995385563 14 Left 995385558 5:111585055-111585077 CCGTCAATGCAGATCAACTTTTT No data
Right 995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995385563 Original CRISPR CTGTGAGAATGCAGGGAAAT AGG Intergenic
No off target data available for this crispr