ID: 995391329

View in Genome Browser
Species Human (GRCh38)
Location 5:111643033-111643055
Sequence AAGTAAGCACGGAAAGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995391329_995391331 28 Left 995391329 5:111643033-111643055 CCAAGCTCTTTCCGTGCTTACTT No data
Right 995391331 5:111643084-111643106 GAGAGTATTTGCCAATCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995391329 Original CRISPR AAGTAAGCACGGAAAGAGCT TGG (reversed) Intergenic
No off target data available for this crispr