ID: 995392924

View in Genome Browser
Species Human (GRCh38)
Location 5:111659427-111659449
Sequence CTAAGTTTCTTACAGGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995392924_995392929 2 Left 995392924 5:111659427-111659449 CCAATAACCTGTAAGAAACTTAG No data
Right 995392929 5:111659452-111659474 CCTTATCCCAACAATCCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995392924 Original CRISPR CTAAGTTTCTTACAGGTTAT TGG (reversed) Intergenic
No off target data available for this crispr