ID: 995392929

View in Genome Browser
Species Human (GRCh38)
Location 5:111659452-111659474
Sequence CCTTATCCCAACAATCCTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995392926_995392929 -5 Left 995392926 5:111659434-111659456 CCTGTAAGAAACTTAGGCCCTTA No data
Right 995392929 5:111659452-111659474 CCTTATCCCAACAATCCTCGAGG No data
995392922_995392929 8 Left 995392922 5:111659421-111659443 CCCTATCCAATAACCTGTAAGAA No data
Right 995392929 5:111659452-111659474 CCTTATCCCAACAATCCTCGAGG No data
995392923_995392929 7 Left 995392923 5:111659422-111659444 CCTATCCAATAACCTGTAAGAAA No data
Right 995392929 5:111659452-111659474 CCTTATCCCAACAATCCTCGAGG No data
995392921_995392929 9 Left 995392921 5:111659420-111659442 CCCCTATCCAATAACCTGTAAGA No data
Right 995392929 5:111659452-111659474 CCTTATCCCAACAATCCTCGAGG No data
995392924_995392929 2 Left 995392924 5:111659427-111659449 CCAATAACCTGTAAGAAACTTAG No data
Right 995392929 5:111659452-111659474 CCTTATCCCAACAATCCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995392929 Original CRISPR CCTTATCCCAACAATCCTCG AGG Intergenic
No off target data available for this crispr