ID: 995398669

View in Genome Browser
Species Human (GRCh38)
Location 5:111716836-111716858
Sequence TTATCTACAAGCCCCTGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1947
Summary {0: 14, 1: 486, 2: 645, 3: 496, 4: 306}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995398653_995398669 26 Left 995398653 5:111716787-111716809 CCACAGCCATCCCTTCCCCCAGG 0: 10
1: 178
2: 398
3: 623
4: 1360
Right 995398669 5:111716836-111716858 TTATCTACAAGCCCCTGACTGGG 0: 14
1: 486
2: 645
3: 496
4: 306
995398662_995398669 8 Left 995398662 5:111716805-111716827 CCAGGTCCTCTGTCCCAGGAAGA 0: 1
1: 46
2: 688
3: 717
4: 685
Right 995398669 5:111716836-111716858 TTATCTACAAGCCCCTGACTGGG 0: 14
1: 486
2: 645
3: 496
4: 306
995398657_995398669 15 Left 995398657 5:111716798-111716820 CCTTCCCCCAGGTCCTCTGTCCC 0: 9
1: 552
2: 694
3: 556
4: 1087
Right 995398669 5:111716836-111716858 TTATCTACAAGCCCCTGACTGGG 0: 14
1: 486
2: 645
3: 496
4: 306
995398656_995398669 16 Left 995398656 5:111716797-111716819 CCCTTCCCCCAGGTCCTCTGTCC No data
Right 995398669 5:111716836-111716858 TTATCTACAAGCCCCTGACTGGG 0: 14
1: 486
2: 645
3: 496
4: 306
995398655_995398669 20 Left 995398655 5:111716793-111716815 CCATCCCTTCCCCCAGGTCCTCT 0: 1
1: 20
2: 402
3: 556
4: 1431
Right 995398669 5:111716836-111716858 TTATCTACAAGCCCCTGACTGGG 0: 14
1: 486
2: 645
3: 496
4: 306
995398661_995398669 9 Left 995398661 5:111716804-111716826 CCCAGGTCCTCTGTCCCAGGAAG No data
Right 995398669 5:111716836-111716858 TTATCTACAAGCCCCTGACTGGG 0: 14
1: 486
2: 645
3: 496
4: 306
995398666_995398669 -5 Left 995398666 5:111716818-111716840 CCCAGGAAGATGGTGGTTTTATC No data
Right 995398669 5:111716836-111716858 TTATCTACAAGCCCCTGACTGGG 0: 14
1: 486
2: 645
3: 496
4: 306
995398660_995398669 10 Left 995398660 5:111716803-111716825 CCCCAGGTCCTCTGTCCCAGGAA 0: 1
1: 49
2: 751
3: 726
4: 733
Right 995398669 5:111716836-111716858 TTATCTACAAGCCCCTGACTGGG 0: 14
1: 486
2: 645
3: 496
4: 306
995398652_995398669 27 Left 995398652 5:111716786-111716808 CCCACAGCCATCCCTTCCCCCAG 0: 6
1: 186
2: 393
3: 585
4: 1205
Right 995398669 5:111716836-111716858 TTATCTACAAGCCCCTGACTGGG 0: 14
1: 486
2: 645
3: 496
4: 306
995398667_995398669 -6 Left 995398667 5:111716819-111716841 CCAGGAAGATGGTGGTTTTATCT 0: 1
1: 7
2: 202
3: 733
4: 820
Right 995398669 5:111716836-111716858 TTATCTACAAGCCCCTGACTGGG 0: 14
1: 486
2: 645
3: 496
4: 306
995398664_995398669 2 Left 995398664 5:111716811-111716833 CCTCTGTCCCAGGAAGATGGTGG 0: 1
1: 0
2: 2
3: 41
4: 247
Right 995398669 5:111716836-111716858 TTATCTACAAGCCCCTGACTGGG 0: 14
1: 486
2: 645
3: 496
4: 306
995398659_995398669 11 Left 995398659 5:111716802-111716824 CCCCCAGGTCCTCTGTCCCAGGA 0: 1
1: 50
2: 634
3: 694
4: 778
Right 995398669 5:111716836-111716858 TTATCTACAAGCCCCTGACTGGG 0: 14
1: 486
2: 645
3: 496
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995398669 Original CRISPR TTATCTACAAGCCCCTGACT GGG Intronic