ID: 995399129

View in Genome Browser
Species Human (GRCh38)
Location 5:111720720-111720742
Sequence AGACCCAGGAAAGCTAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995399129_995399134 3 Left 995399129 5:111720720-111720742 CCAACACTAGCTTTCCTGGGTCT 0: 1
1: 0
2: 4
3: 22
4: 191
Right 995399134 5:111720746-111720768 GCTTGAAGATGGCAGATCATGGG 0: 1
1: 31
2: 124
3: 330
4: 813
995399129_995399131 -8 Left 995399129 5:111720720-111720742 CCAACACTAGCTTTCCTGGGTCT 0: 1
1: 0
2: 4
3: 22
4: 191
Right 995399131 5:111720735-111720757 CTGGGTCTCCAGCTTGAAGATGG 0: 2
1: 80
2: 278
3: 511
4: 835
995399129_995399133 2 Left 995399129 5:111720720-111720742 CCAACACTAGCTTTCCTGGGTCT 0: 1
1: 0
2: 4
3: 22
4: 191
Right 995399133 5:111720745-111720767 AGCTTGAAGATGGCAGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995399129 Original CRISPR AGACCCAGGAAAGCTAGTGT TGG (reversed) Intronic
901127548 1:6940250-6940272 AAACCCAGGAGAGCTGGTTTTGG + Intronic
901133805 1:6979887-6979909 AGAGCCAGGAAAGCTAGATGAGG - Intronic
901152716 1:7114664-7114686 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152724 1:7114713-7114735 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152732 1:7114762-7114784 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152740 1:7114811-7114833 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152748 1:7114860-7114882 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152756 1:7114909-7114931 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152764 1:7114958-7114980 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152772 1:7115007-7115029 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152780 1:7115056-7115078 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152788 1:7115105-7115127 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152796 1:7115154-7115176 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152804 1:7115203-7115225 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152812 1:7115252-7115274 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152820 1:7115301-7115323 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152828 1:7115350-7115372 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152836 1:7115399-7115421 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152844 1:7115448-7115470 AGACCCAGGAGAGCTGATGGTGG + Intronic
901152852 1:7115497-7115519 AGACCCAGGAGAGCTGATGGTGG + Intronic
902808365 1:18874664-18874686 TGAACCTGGAAAGCCAGTGTGGG - Intronic
903702101 1:25256910-25256932 AGACTGAGGAAAGCAAGTGAAGG - Intronic
905351888 1:37352774-37352796 AGACCTAGGAAAGCCAATATGGG + Intergenic
906110267 1:43317827-43317849 AGACACAGGCAACCTAGGGTGGG - Intronic
908296901 1:62721570-62721592 AGAGGCAGGGAAGCTGGTGTTGG + Intergenic
910838703 1:91540964-91540986 GGACCCAGGAAATCTAGTAGAGG - Intergenic
911978145 1:104529483-104529505 AGAGCCAGAAAAGATAGTGGGGG + Intergenic
913049106 1:115100180-115100202 AGACCCAGGAGAGCTAATAGTGG + Intergenic
913394203 1:118348433-118348455 AGATGAAAGAAAGCTAGTGTGGG + Intergenic
919994048 1:202731249-202731271 AGACTTAGGAAATCTAGTTTTGG - Intronic
920858128 1:209680164-209680186 AGACAAAAGAAAGCAAGTGTTGG - Intergenic
922981165 1:229828134-229828156 AGCCACAGGAAAGATAGTGATGG + Intergenic
924809337 1:247387565-247387587 AGAGCCAGGAAAGCCAGTCGGGG + Intergenic
1062899800 10:1134425-1134447 AGGCCCAAGAGAGCTAGTGGTGG - Intergenic
1063607282 10:7533755-7533777 AGACCCAGGAGAGCTAATGGTGG + Intergenic
1068367671 10:56071776-56071798 AGACCAAGGAAAGGTTGAGTTGG + Intergenic
1068611988 10:59070267-59070289 AGAGCCAGGAAAACCAGTGATGG + Intergenic
1068800216 10:61132099-61132121 AGACCCAGGAATGGAAGTTTTGG + Intergenic
1069592566 10:69651066-69651088 AGCCCCAGGAAACCCAGCGTTGG - Intergenic
1071560926 10:86646453-86646475 AGCCCCAGGAAGACTACTGTGGG + Intergenic
1072167100 10:92824445-92824467 AGAGACAGGAAAACTAGTTTGGG + Intergenic
1072565593 10:96614183-96614205 AGGCCCAGGAGTCCTAGTGTTGG - Intronic
1077901695 11:6495242-6495264 AGAACCAGGAAATCTGGTGGTGG + Intronic
1079562471 11:21839560-21839582 ATACTCAGGAAAGCTACTGAGGG + Intergenic
1079729800 11:23925847-23925869 TGACCCAGGAATGCTATTGCTGG + Intergenic
1081106390 11:39075193-39075215 AGAACCAGGGAAGCTAATGATGG - Intergenic
1083079575 11:60076666-60076688 AGACCAAAGATAGCAAGTGTTGG + Intergenic
1083736516 11:64684776-64684798 AGGCCCAGGATGGCTAGTGCAGG - Intronic
1084325825 11:68399552-68399574 ACACCCAGGAACGCCAGTGCCGG - Intronic
1085686909 11:78631717-78631739 AGGCACAGCAAAGCGAGTGTGGG - Intergenic
1086634542 11:89065629-89065651 AGACCCAGGAGGGCAAGTGGTGG - Intronic
1092651275 12:10637682-10637704 ATATCCATGAAAGCTAATGTGGG + Intronic
1094202936 12:27811667-27811689 AGAGCCAGGACAGCCAGTGGTGG + Intergenic
1099239057 12:80116660-80116682 AATCCCAGGAAAGCTGGTGTGGG + Intergenic
1099624633 12:85054296-85054318 AGACAAAGGAAAAATAGTGTTGG + Intronic
1100076989 12:90797314-90797336 AGACCCAGCAAAGCTATGCTGGG - Intergenic
1100239411 12:92696364-92696386 AGACCCAGCAAAGGCACTGTGGG - Intergenic
1100338621 12:93656664-93656686 AGAACCAGGAGAGCTAGTGATGG + Intergenic
1101326886 12:103723664-103723686 AGACCCAGAGAAGTTAGAGTGGG + Intronic
1106593579 13:31118380-31118402 TGACCCAAGAAGGCCAGTGTGGG - Intergenic
1107271121 13:38617729-38617751 ACACCAAGGAAAGCCAGTTTGGG - Intergenic
1108526846 13:51292856-51292878 CTTCCCAGGAAACCTAGTGTCGG - Intergenic
1108717170 13:53092334-53092356 AGACCCAGGAAAAATGGTGTTGG + Intergenic
1110087741 13:71403724-71403746 AGACTCAGGAGAGCCAGTGGTGG + Intergenic
1110348566 13:74478631-74478653 TGACCCAGGAAAGCTAGTGATGG + Intergenic
1122070749 14:99204039-99204061 AGAGCCTGGAAGGCTAGGGTGGG - Intronic
1128659788 15:69490452-69490474 AGAACCAGGAGAGCAAGCGTGGG - Intergenic
1128805063 15:70524631-70524653 AGGCCCTGAAAAGCTGGTGTGGG + Intergenic
1128809596 15:70561234-70561256 GGAGCCATGAAAGCTAGTGATGG + Intergenic
1129653105 15:77505424-77505446 AGACCCTGGCAAGGTCGTGTAGG + Intergenic
1130395434 15:83496997-83497019 AGACATAGGAAAGATAGTGGAGG - Intronic
1131077773 15:89506658-89506680 AGACCCAGGAGAGCTGATGGTGG - Intergenic
1132108946 15:99087982-99088004 AGACCCAGGGCTGCTAGTATGGG - Intergenic
1132152391 15:99471709-99471731 AGACCCAGGAAAGCTGGTGGTGG - Intergenic
1133809697 16:9151861-9151883 AGACCAAGGAAAGATTGTTTGGG + Intergenic
1134668655 16:16038337-16038359 AGACCCAGGGAAGCTGATGGTGG + Intronic
1136549352 16:30974377-30974399 AGACCCAGGTAGGCGAGTGGGGG + Intronic
1139196411 16:64923909-64923931 AAACCCAGGAATGTTAGGGTTGG - Intergenic
1140912081 16:79463233-79463255 AGAGCCATGAAAGCTATGGTAGG + Intergenic
1141733009 16:85834856-85834878 AGACCCAAGCAAGCCAGTGAGGG + Intergenic
1141856534 16:86684940-86684962 ACACCCAGGAAGGCCAGTTTGGG + Intergenic
1142020767 16:87780832-87780854 AGACACAGGAAAGCTAGACTGGG - Intergenic
1142433818 16:90044666-90044688 AGACCCAGGAAAGCTGGGGTGGG - Exonic
1142613579 17:1122650-1122672 AGACCCAGGACAGCCAATATTGG - Intronic
1144832016 17:18137006-18137028 AGACCCAGCAAAGGCACTGTAGG + Intronic
1146563047 17:33888307-33888329 AGGCCCAGCATAGCAAGTGTGGG + Intronic
1148115576 17:45172794-45172816 AGACCCAGGAAGGAGAGTGGGGG - Intergenic
1149261988 17:54890291-54890313 AGACCCAGGCCTGTTAGTGTAGG - Intergenic
1153545195 18:6197686-6197708 TGCCCCAGGAAGGCCAGTGTTGG - Intronic
1153670651 18:7408888-7408910 AGACAAAGGATAGCAAGTGTTGG - Intergenic
1154316779 18:13310529-13310551 AGAACCAGGAAAGCCAGAGCAGG + Intronic
1155677080 18:28441806-28441828 ACACCCAGGGAGGCTATTGTGGG - Intergenic
1155889607 18:31250340-31250362 AGTCCCAGGATAGCTTCTGTCGG + Intergenic
1156130034 18:33961486-33961508 ATATCCAGGAAAGCCAGTGGTGG - Intronic
1158371585 18:56812550-56812572 AGACCCAGCGAAGCTGGTGGTGG + Intronic
1160039458 18:75332805-75332827 TCTCCCAGGAAAGCTGGTGTGGG + Intergenic
1160303530 18:77708736-77708758 AGAAACAGGAAAGCTGGTGCTGG + Intergenic
1163367054 19:16881135-16881157 TGACCAAGGAAAGCCAGTCTGGG - Intergenic
1165184212 19:34002797-34002819 AGCCCCAGGAGAGCCAGGGTGGG + Intergenic
1166420857 19:42634930-42634952 AGACCCAGGGAAGCTAAAGAAGG - Intronic
1168212605 19:54901484-54901506 AGTCCCAGGAATGCTGGTGTGGG + Intergenic
925569121 2:5289911-5289933 AGGGCCAGGAAAGCCAGTGGTGG - Intergenic
925641361 2:5988707-5988729 AGGCCCAGCAAAGCTGGTGGTGG + Intergenic
925729975 2:6912787-6912809 AGACCCTGAAAAGCTGGTGGTGG + Intergenic
927460201 2:23292257-23292279 AGACCCATGCAAGCTACTGCAGG - Intergenic
928858847 2:35831524-35831546 AAACCCAGGAAAGCCAATGGTGG + Intergenic
930417118 2:51103163-51103185 AGAGCCTGTAAAGCTAGTGTTGG - Intergenic
931029904 2:58161956-58161978 ACACCTAGCAAAGCTATTGTAGG + Intronic
932923834 2:75947161-75947183 AGAACCAGGAAAGGTAGTGGGGG + Intergenic
933560782 2:83883452-83883474 AGACCCAGGGAAGCTGGTGGTGG + Intergenic
935284242 2:101549775-101549797 AGAGCCAAGTAAGCTAGTTTGGG - Intergenic
937457597 2:122055814-122055836 AGGAGCAGGAAAGCTAGTGGAGG - Intergenic
937667079 2:124499937-124499959 AGACCCAGGAAAGTCAGTGCTGG + Intronic
939007241 2:136803825-136803847 AGAACCAGGAGTGCCAGTGTGGG + Intronic
942535621 2:176960096-176960118 AAACCGATTAAAGCTAGTGTAGG - Intergenic
947320619 2:228914098-228914120 GGACTCAGGAAACCTAGTTTTGG - Intronic
1169982206 20:11397073-11397095 AGGCCCAGGAAAGTCAGTGGTGG - Intergenic
1170612039 20:17922625-17922647 AGACCCAGGAAAGCTGGTGGTGG - Intergenic
1170786578 20:19472683-19472705 GTTCCCAGGAAAGCCAGTGTAGG - Intronic
1170948873 20:20916133-20916155 AGATCCAGGAAGTCTAGTTTGGG + Intergenic
1171721276 20:28565553-28565575 AGACCCAGGACTGCCAATGTTGG + Intergenic
1172667115 20:36607950-36607972 AGACCCAGGAGTGCCACTGTAGG - Intronic
1173203176 20:40969074-40969096 AGCCTCAGGACAGCAAGTGTGGG + Intergenic
1175650083 20:60713911-60713933 ATTCCCTGGAAAGCTAGTTTGGG - Intergenic
1177723477 21:24937729-24937751 AGATGGAGGAAAGCTGGTGTTGG + Intergenic
1179120706 21:38543074-38543096 AGATCCAGAAAGGGTAGTGTTGG - Intronic
1179500856 21:41807823-41807845 AGACCCAGGGAAGGTGGTGCGGG - Intronic
1182511080 22:30820918-30820940 AGACCCAGGGAAGGTGGTGCTGG - Intronic
1184332025 22:43833391-43833413 GGACCCAGGAAGGCGGGTGTGGG - Intronic
951461008 3:22952109-22952131 TGACCCAGGAATGCTAATGTTGG - Intergenic
952359160 3:32612403-32612425 AGACACAGCAAAGATACTGTGGG + Intergenic
953292368 3:41678072-41678094 AGACCCAGGAGAGCCTGTGATGG - Intronic
954205274 3:49054256-49054278 AGGCCCAGGAGAGCTAGGGGAGG + Intronic
955878066 3:63514485-63514507 AAACCCAGGAAAGCAAATGGTGG - Intronic
956597812 3:70987508-70987530 AGACATAGGAAACCTAGTGTTGG - Intronic
959237547 3:103744337-103744359 AGAACCAGGAAAGCTGGTGATGG + Intergenic
963032710 3:140994873-140994895 AGACCCAAGAGAGCCAGTGCTGG + Intergenic
964417566 3:156463520-156463542 AGACAAAGGGAAGCTAGTGCGGG - Intronic
965115877 3:164487406-164487428 AGACCCAGGACAGGTAATGGTGG - Intergenic
966141442 3:176761602-176761624 AGAACCAGGGAAGCCAGTGATGG + Intergenic
968694999 4:2019980-2020002 ATAGCCAGGAATGCTGGTGTGGG - Intronic
971552115 4:27970486-27970508 AGCACCATGGAAGCTAGTGTGGG - Intergenic
974318642 4:60314916-60314938 AGACCCAGGAAAGCCAATGACGG - Intergenic
979492333 4:121342303-121342325 ATGCCCAGGAAAGCCAGTGGTGG - Intronic
981442732 4:144801185-144801207 AGACCCAGGAAAGCCATTGGTGG - Intergenic
981670638 4:147282799-147282821 AGACCAAAGATAGCAAGTGTTGG + Intergenic
982322494 4:154093904-154093926 AGACCCAGTAAAGGGATTGTTGG + Intergenic
983489367 4:168369908-168369930 AGACAAAAGAAAGCAAGTGTTGG + Intronic
987421447 5:17725245-17725267 GGACCCAGGAAAGAGGGTGTTGG + Intergenic
987998833 5:25323048-25323070 AGCCCTAGGAAAGCTGATGTGGG - Intergenic
988264325 5:28928907-28928929 AGCCCCTGGAATCCTAGTGTGGG - Intergenic
993535266 5:89076375-89076397 AGACCCAGGAAAGCTGAAGGTGG + Intergenic
994163168 5:96579650-96579672 AGAACAAGGAAAACTGGTGTGGG - Intronic
995303281 5:110611415-110611437 AGTTCCAGGGAAGCTGGTGTGGG + Intronic
995399129 5:111720720-111720742 AGACCCAGGAAAGCTAGTGTTGG - Intronic
997444531 5:133931733-133931755 AGGGCCAGGAAAGCAAGGGTGGG + Intergenic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
1004249477 6:14011738-14011760 AGAACCAGAAAAGCCAGTGGGGG + Intergenic
1004249542 6:14012272-14012294 AGAACCAGGAGTGCCAGTGTCGG + Intergenic
1006105211 6:31712328-31712350 AGATCCACGGAAGCTAGTGGAGG + Exonic
1006434535 6:34019367-34019389 AGCCCCAGGCAAGCTCGAGTGGG + Intronic
1006755483 6:36411615-36411637 ATACACTGGATAGCTAGTGTGGG - Intronic
1006939199 6:37740489-37740511 AGACCCAGGAAAGCTATCCTGGG - Intergenic
1007005904 6:38361993-38362015 AGAGCCAGAAAAGCAAGTGGAGG - Intronic
1007234093 6:40378170-40378192 CCACCCAGGAAAGCTGGTCTAGG + Intergenic
1013086260 6:106860409-106860431 AGTCATAGGAAGGCTAGTGTTGG - Intergenic
1013700104 6:112756874-112756896 AGAACCAGGAAAGCCAATGGTGG - Intergenic
1018347812 6:162921201-162921223 AGACCCAGGAGAGACAGAGTGGG + Intronic
1018680907 6:166263851-166263873 AGACCCAGGCTTGCTAGTGTGGG - Intergenic
1019095341 6:169575099-169575121 AGCCCCAGGATAGCTGGTGGTGG - Intronic
1020355112 7:7267064-7267086 AGACCCAAGAAAGCAGGTGGTGG - Intergenic
1022312794 7:29212924-29212946 AGACCCAGAACATCTAGTGCTGG + Intronic
1023045413 7:36206076-36206098 TGAACCAGGAAAGCTTCTGTGGG - Intronic
1023494470 7:40779739-40779761 AACCCCAGCAAAGCTATTGTGGG - Intronic
1024253268 7:47521944-47521966 AGACCCAGGGAAGCTGGGTTAGG + Intronic
1027942275 7:84698280-84698302 AGACTCAGTAAGGCTAGAGTAGG + Intergenic
1028827884 7:95294619-95294641 AGTCTCAGGAAATCTAGTCTTGG + Intronic
1028978180 7:96937394-96937416 AGACCCAAGAAAGCAGGTGGTGG + Intergenic
1030071545 7:105702315-105702337 AAACCCAGGAAAACTAGGTTTGG - Intronic
1030108687 7:106008376-106008398 AGGCCCAGGGAAGCCAGTGGAGG - Intronic
1031607972 7:123792555-123792577 AGACCCAGTCAAGCAGGTGTGGG - Intergenic
1031859407 7:126960661-126960683 AGACCCAGAAAAACTATTTTTGG + Intronic
1033528836 7:142243555-142243577 AGGCTCAGGAAAGCTGGGGTGGG + Intergenic
1034474502 7:151274888-151274910 ACACGCAGGAAAGGGAGTGTGGG + Intronic
1036094742 8:5711424-5711446 AGGCCCAGGAAAGCCAGTGGTGG + Intergenic
1041084411 8:54243581-54243603 ACAGCCAGGAAAGCTAGGGGTGG - Intergenic
1041354630 8:56987517-56987539 AGAACCAGGAGAGCTGGTGGTGG - Intronic
1041507820 8:58620799-58620821 AGACCGAGGAGAGCTAATGGGGG + Intronic
1042869898 8:73388971-73388993 AGCTCCAGAATAGCTAGTGTGGG - Intergenic
1043682057 8:83040634-83040656 TGCCTCAGTAAAGCTAGTGTAGG + Intergenic
1043840640 8:85099622-85099644 AGTTCCAGGAAAGCTTCTGTTGG + Intergenic
1045235595 8:100350368-100350390 AGAACCCGGAAAGCCAGTGGTGG - Intronic
1045491314 8:102671370-102671392 AGACCCAGGAAAGCAGGAGGAGG - Intergenic
1048123260 8:131605454-131605476 AGCCCCAGGAGAGCGAGTGATGG + Intergenic
1048144943 8:131832368-131832390 AGCCCCTGGGAAGCTTGTGTTGG - Intergenic
1048311801 8:133328570-133328592 AGCCCAAGGAAAGACAGTGTGGG - Intergenic
1049260211 8:141634954-141634976 AGACCCTGGAATAATAGTGTGGG + Intergenic
1050096662 9:2074423-2074445 AGACCCTGGTAAGCTATTATGGG - Intronic
1050233767 9:3556524-3556546 AAACCCTGGAAAGATAGTGTGGG + Intergenic
1050487613 9:6150578-6150600 AGAACCAGGATTGCTAATGTTGG + Intergenic
1054734901 9:68741295-68741317 TGACCAAGGAAATCTAGTTTTGG - Intronic
1054904890 9:70406103-70406125 AGTCCCAGGAGAGCAAGTGGGGG + Intronic
1056192272 9:84196002-84196024 GGAACCAGGAAAGCCAGTGGCGG - Intergenic
1057319438 9:93998925-93998947 AGACCCAGGAGAGCTGGTGGTGG + Intergenic
1057561099 9:96128468-96128490 AGCTCCATGAAAGCTAGGGTAGG + Intergenic
1057993629 9:99799163-99799185 AGACCCAGGAAAGGTGGTGATGG + Intergenic
1058762617 9:108149851-108149873 AGACCCAGAATAGTTCGTGTAGG + Intergenic
1059356895 9:113706776-113706798 AGACCCAGGAGACCTAATGGTGG - Intergenic
1060403701 9:123362480-123362502 AGGCCCAGGAAAGAAAGTGAAGG - Intronic
1060886405 9:127155523-127155545 AGAGGCTGGAAAGGTAGTGTGGG + Intronic
1185509655 X:653979-654001 AGAGCCAAGAAAAATAGTGTCGG + Intronic
1188671634 X:32888498-32888520 AGACAAAGGATAACTAGTGTTGG + Intronic
1193327333 X:80194636-80194658 AGACAAAGGAAAGCAAGAGTTGG - Intergenic
1195683162 X:107563802-107563824 GGACTCAGGAAACCTAGGGTAGG - Intronic
1196837958 X:119830656-119830678 AAACCAAGGTAAGCTAGTGAAGG + Intergenic
1198838536 X:140831401-140831423 AGAACCAGGAAAGCCAGTGGTGG + Intergenic
1199460696 X:148081396-148081418 AGACCTCTGAGAGCTAGTGTTGG - Intergenic
1201304955 Y:12542210-12542232 TGACCCAGGAGAGGAAGTGTTGG + Intergenic