ID: 995400952

View in Genome Browser
Species Human (GRCh38)
Location 5:111741088-111741110
Sequence TATCCCTGATGGGGTCCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995400948_995400952 -1 Left 995400948 5:111741066-111741088 CCATAACTGTAATGTTATTCTTT 0: 1
1: 0
2: 1
3: 30
4: 416
Right 995400952 5:111741088-111741110 TATCCCTGATGGGGTCCTATAGG 0: 1
1: 0
2: 0
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995400952 Original CRISPR TATCCCTGATGGGGTCCTAT AGG Intronic