ID: 995402311

View in Genome Browser
Species Human (GRCh38)
Location 5:111757215-111757237
Sequence CTAGAAAGACAGATTGGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995402302_995402311 13 Left 995402302 5:111757179-111757201 CCTGAAACACAAATGTGGTTGAA 0: 2
1: 0
2: 4
3: 47
4: 317
Right 995402311 5:111757215-111757237 CTAGAAAGACAGATTGGGGGGGG 0: 1
1: 0
2: 2
3: 31
4: 254
995402300_995402311 23 Left 995402300 5:111757169-111757191 CCTCTCTACACCTGAAACACAAA 0: 3
1: 0
2: 1
3: 18
4: 419
Right 995402311 5:111757215-111757237 CTAGAAAGACAGATTGGGGGGGG 0: 1
1: 0
2: 2
3: 31
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995402311 Original CRISPR CTAGAAAGACAGATTGGGGG GGG Intronic
902579778 1:17401179-17401201 TTAGAAAGACAGGGTGGGTGAGG - Intronic
904011201 1:27391630-27391652 CTAGAAAGCCAGCGTGGAGGGGG - Intergenic
904678204 1:32211551-32211573 TGTGAAACACAGATTGGGGGAGG + Intronic
905386759 1:37609937-37609959 CTTGAAAGACAGATTAGGGAGGG - Intergenic
905512907 1:38536935-38536957 TTAGAAAGCCAGATTGAGGACGG + Intergenic
905527461 1:38649824-38649846 CTAGACAGACATATGGGGTGAGG + Intergenic
906210518 1:44010249-44010271 GTTGAAAGACAGGCTGGGGGTGG - Intronic
906353145 1:45080726-45080748 CCAGAAAGAAAGATTGAGGAAGG - Intronic
907092590 1:51741540-51741562 AGAGAAAGAGAGGTTGGGGGAGG - Intronic
908277768 1:62493566-62493588 CCAGACAAATAGATTGGGGGAGG - Intronic
909435901 1:75641948-75641970 CCAGAAAGGCAGATTGTGGTTGG - Intergenic
911197086 1:95005509-95005531 GAAGTAAGACAGATTGGGAGTGG + Intronic
914938732 1:152003448-152003470 CTAGAAAGAGGGATTGGGTGAGG + Intergenic
915134629 1:153722043-153722065 AAAGAAAGAAAGATTTGGGGTGG - Intergenic
915860825 1:159442315-159442337 CTAAAAAGCCATATAGGGGGAGG + Intergenic
918457488 1:184737943-184737965 CTAGGAAGTGAGATTGGGGAGGG - Intronic
920496080 1:206455817-206455839 CTAGACAGCCAGATCGGGCGTGG - Intronic
920760568 1:208780138-208780160 CTGGAAAGACAGGTTTGGGAAGG - Intergenic
923515408 1:234694046-234694068 CTAGAAAGAGAAATTGGGCTTGG - Intergenic
923612684 1:235509443-235509465 CTGGAAAGAAAGATTGGGGTGGG - Intergenic
924364361 1:243275301-243275323 CTAGAAAGAAAGAAAGAGGGAGG - Intronic
924407890 1:243770964-243770986 CTAAAAAGATATATGGGGGGAGG + Intronic
1063114816 10:3066562-3066584 CTGGAAAGTCAGAGTGGGGCAGG - Intronic
1063166100 10:3463821-3463843 CTTGAAAGACAGCTTAGGGGAGG + Intergenic
1064133474 10:12730493-12730515 CTATAGATACACATTGGGGGTGG + Intronic
1065011555 10:21425545-21425567 CTAGAAGGACAGACTGGGCATGG + Intergenic
1065253376 10:23839802-23839824 CTACAAAGACAGATTTGTGGTGG - Intronic
1065399077 10:25275532-25275554 CCAGGAAGAGAGATTTGGGGTGG + Intronic
1066277382 10:33882138-33882160 CCAGAAACGCAGATTGGTGGTGG + Intergenic
1067420445 10:46140850-46140872 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1067425576 10:46208683-46208705 CTGGAAAGACAGAATGGGGCTGG - Intergenic
1067505789 10:46847331-46847353 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1072376630 10:94823380-94823402 CTAGAAAGGCAGATTTGGTAAGG + Intronic
1073775308 10:106778776-106778798 CTAGAAAATCAGAGTGGGGAAGG - Intronic
1075673818 10:124282193-124282215 CAAGAGAGAGAGAGTGGGGGGGG + Intergenic
1077336247 11:2005984-2006006 CTAGAAGGTCAGAGTCGGGGTGG + Intergenic
1077423080 11:2462068-2462090 CCAGAAAGACACAGTGGGGCTGG - Intronic
1079119792 11:17673682-17673704 TTTGAAAGACAGATTGGGGAAGG - Intergenic
1079884682 11:25972471-25972493 CCAGAAAGGCAGGATGGGGGTGG + Intergenic
1080703706 11:34668193-34668215 CTGGAAAGACAGGTTTGGAGGGG - Intergenic
1081437107 11:43039356-43039378 CAAGTAAGGGAGATTGGGGGTGG + Intergenic
1081756065 11:45545395-45545417 CCAGAGACACAGATTGGGAGAGG + Intergenic
1081876475 11:46411763-46411785 TTAAAAAGACAGATTTGGGCTGG - Intronic
1082036368 11:47648425-47648447 CTAGAAAAACAGGTTGTAGGAGG - Intergenic
1083455161 11:62773862-62773884 CTAGACAAAGGGATTGGGGGTGG + Intronic
1084353281 11:68618921-68618943 CTTGAAAGACAAATGGGCGGGGG - Intergenic
1085449988 11:76626052-76626074 ATAGACAGACAGATGGGTGGCGG + Intergenic
1085470531 11:76754525-76754547 CTAGGGGGACTGATTGGGGGAGG - Intergenic
1086275809 11:85127245-85127267 ATAGAAAGAGAGAGTGGGTGGGG - Intronic
1087190458 11:95249008-95249030 AGAGAAAGAGAGAGTGGGGGAGG + Intergenic
1089328176 11:117671752-117671774 TTAGAAAGGCAGAGTGGGCGGGG + Intronic
1089526831 11:119102456-119102478 CAAGAAAAACAGAGTGGGAGGGG - Intronic
1090140961 11:124260973-124260995 CTGGAAAGACTGACTGGGTGTGG - Intergenic
1202819231 11_KI270721v1_random:61166-61188 CTAGAAGGTCAGAGTCGGGGTGG + Intergenic
1094474618 12:30831838-30831860 ATAGAAAGAAAGATGGAGGGAGG - Intergenic
1096924953 12:55133678-55133700 CTAGAAGGGCTGATTGGGGAGGG + Intergenic
1097705581 12:62865382-62865404 CTAGAGAGACAGAGGAGGGGAGG - Intronic
1098422057 12:70308404-70308426 AGAGAAAGACAGATGGAGGGAGG - Intronic
1098665294 12:73153638-73153660 TTAAAAAGATAGTTTGGGGGAGG - Intergenic
1100866689 12:98865171-98865193 ATAGCAAGAAAGATTTGGGGTGG - Intronic
1100891879 12:99134575-99134597 AGAGAAAGAGAGATTGGGGTGGG - Intronic
1101154131 12:101911581-101911603 CTAGCAAGACAAAGTGGAGGAGG - Intronic
1102679792 12:114683683-114683705 AGAGGAAGACAGATAGGGGGCGG - Intronic
1103236296 12:119375564-119375586 ATAGAGAGACAGTTGGGGGGAGG - Intronic
1104357635 12:128101709-128101731 CTAGAGAGACAGCTGGGTGGAGG - Intergenic
1105470830 13:20693237-20693259 TTAGTAAGATAGATTTGGGGGGG + Intergenic
1108238285 13:48432241-48432263 CTGGAAATACAGATTGGAGAAGG - Intronic
1112686885 13:101839393-101839415 ATAGAAAGACAGATTGGGTTTGG + Intronic
1112724911 13:102292100-102292122 CCAGAAAAACAAATTGGCGGGGG - Intronic
1113029687 13:105979229-105979251 GTAGAAAGACAGATTAGGAGAGG + Intergenic
1113829329 13:113282694-113282716 TTAAAAAGACAAATTGGGAGTGG + Intergenic
1115097183 14:29650553-29650575 CCAGAGAGACTGAATGGGGGGGG + Intronic
1115803222 14:37019753-37019775 CTAGAAAGGGACATTGGGGCTGG + Intronic
1116729429 14:48603336-48603358 GAAGAAAGAAAGATTAGGGGAGG - Intergenic
1118010442 14:61605270-61605292 CTAGAAAGAAAAGTTGAGGGGGG + Intronic
1118817906 14:69325711-69325733 CTAGAAAGCACGCTTGGGGGTGG - Intronic
1118935147 14:70281080-70281102 CTTGATAAACAGGTTGGGGGTGG + Intergenic
1119311911 14:73654460-73654482 CAATAAAGACAAATTGGGGCTGG + Intronic
1119685582 14:76628441-76628463 CAAGGAAGACAGATTGTGGGTGG - Intergenic
1120894593 14:89518397-89518419 CTGGCAAGACTGATTGGAGGAGG + Intronic
1121568417 14:94928095-94928117 CTAGAAATAGACAGTGGGGGTGG - Intergenic
1121714118 14:96060596-96060618 GGAGAAAGACAGAGTGGGGAAGG - Intronic
1122913842 14:104846910-104846932 CTAGAGGGACAGGTTGGGGGAGG + Intergenic
1128868726 15:71136294-71136316 CTAGAATGTCAGACTGGGGACGG + Intronic
1129366257 15:75057108-75057130 TTAGAAAAACAGATTGGTGGTGG + Intronic
1133666593 16:7974128-7974150 CTAGAAAGACAGAAGCGTGGAGG - Intergenic
1134346814 16:13398963-13398985 CTAGAAATACAGATAGGGCGTGG + Intergenic
1135871380 16:26154544-26154566 GTAGAAAGGCAGCTTGGGGATGG - Intergenic
1138770242 16:59654090-59654112 ATAGAAAGAAAGATGGGGGCGGG + Intergenic
1139954633 16:70687185-70687207 TGAGAAAGGCAGATTGGGGAAGG + Intergenic
1140809429 16:78563003-78563025 AAAGAAAGAAAGATAGGGGGAGG - Intronic
1140871479 16:79110611-79110633 CAAGAGAGACAGAGTGGGGACGG - Intronic
1143004011 17:3815213-3815235 TTAGAAAGACAACTTGAGGGTGG - Intronic
1143501792 17:7343566-7343588 CCAGGAAGACAGATTGGGGCAGG - Intronic
1144465587 17:15494196-15494218 CTAAAAATACAGAGTGGTGGTGG + Intronic
1150680018 17:67277078-67277100 CTACAAAGACAGACTGGGATGGG - Intergenic
1150842470 17:68621719-68621741 TTTCAAAGAGAGATTGGGGGGGG + Intergenic
1151333900 17:73428774-73428796 CAAGGAAGACAGACTGGGGTGGG + Intronic
1152431905 17:80252984-80253006 CTAGAATGACAGACTGTGCGAGG + Exonic
1153087271 18:1302636-1302658 CTTGCAAGACAGGTTGGTGGGGG + Intergenic
1154319622 18:13336795-13336817 CTTGAAAGAGAGAGAGGGGGAGG - Intronic
1156889871 18:42178382-42178404 AGAGAGAGACAGAGTGGGGGGGG + Intergenic
1158082453 18:53609018-53609040 CAAAAAAGAGAGATTGGGGTAGG - Intergenic
1158635399 18:59151767-59151789 CTAGAAATACAGCTTGACGGGGG - Intronic
1164951137 19:32338205-32338227 CCAGAAAGGCAGATTGGGGCTGG - Intergenic
1165181666 19:33976904-33976926 CTAGAAACACAGCCTGGAGGAGG + Intergenic
1166880901 19:45929384-45929406 ACAGAAAGACAGAGAGGGGGAGG + Intergenic
1167847359 19:52175514-52175536 CTAGAGATACAGGTTGGGCGGGG - Intergenic
1168592427 19:57648461-57648483 AAAGAAAGACAGACTGAGGGTGG + Intergenic
925282187 2:2692384-2692406 CCAGAAAGACAGACTGTGGGTGG - Intergenic
925283811 2:2703177-2703199 CTTGAAAGAGGGATTGGGGCCGG - Intergenic
925702065 2:6648534-6648556 CTAGACTGACAGATTAAGGGAGG + Intergenic
928663189 2:33524721-33524743 CTGGAAAAACAGGTTGGAGGTGG + Intronic
930213547 2:48669107-48669129 CTGGAAATACAGAGTGGGGATGG - Intronic
930866525 2:56127364-56127386 ATAGAAGGACAGAGTTGGGGAGG - Intergenic
932334827 2:70924211-70924233 CTAGAAGGAAAGAATGGGGGCGG + Intronic
932730971 2:74221818-74221840 CCTCAAAGACAGATTAGGGGTGG - Intronic
932770494 2:74498371-74498393 CTGGAAAGAAAAGTTGGGGGTGG + Intronic
932840689 2:75079491-75079513 CAAGAAAGACAGACTGGGCATGG - Intronic
933322662 2:80796588-80796610 ATAGAAAGAGAGAAGGGGGGAGG - Intergenic
933786463 2:85846700-85846722 CTAGAAAGACAGAGCTGGGAGGG - Intronic
935313448 2:101807755-101807777 AGAGAAAGAAAGAGTGGGGGAGG + Intronic
935693464 2:105750437-105750459 CTAGACAGACACACTGGGAGTGG - Intronic
935869604 2:107431866-107431888 CTAGAATGAGATATTGGGGTGGG - Intergenic
936952127 2:117988445-117988467 GTAGAATGCCAGATTGGCGGTGG - Intronic
937626682 2:124051912-124051934 CCAGAAAGAGAGATTTGGGAGGG - Intronic
938556609 2:132430356-132430378 CTGGAAAGGCAGGCTGGGGGTGG + Intronic
938592988 2:132757600-132757622 CTAGAATGATAAATTGGGTGAGG - Intronic
940348782 2:152657455-152657477 TTAGAAATACTGATTTGGGGTGG - Intronic
940639401 2:156331587-156331609 CCAGAAAGGCAGATTGTGGAAGG - Intronic
942923927 2:181410458-181410480 AGAGAAAGACAGATTGAGGATGG - Intergenic
943850261 2:192711522-192711544 CTAGATAAACAGGTTGAGGGTGG + Intergenic
945243296 2:207696463-207696485 CTAAAAAGACAGGTAGGGGCTGG - Intergenic
945410387 2:209499754-209499776 CCAGAAAGAGAGACAGGGGGTGG + Intronic
945995215 2:216430883-216430905 CAACACAGACAGATGGGGGGAGG - Intronic
946051886 2:216869637-216869659 CTAAAAAGCCAGGTTGGGGTTGG - Intergenic
946051930 2:216870145-216870167 CTAGAAAGAGATCTTGAGGGAGG - Intergenic
946997632 2:225413099-225413121 CTAGAAAAATATGTTGGGGGAGG - Intronic
947266577 2:228288952-228288974 GCAGAAAGACAGATTTGGGATGG + Intergenic
947989245 2:234473893-234473915 CGAGAGAGAGAGAGTGGGGGTGG + Intergenic
1170758765 20:19230608-19230630 ATAGAAAGACATATTGATGGGGG + Intronic
1170758774 20:19230644-19230666 ATAGAAAGACATATTGATGGGGG + Intronic
1172796166 20:37539987-37540009 CTTGAAGCAGAGATTGGGGGAGG + Intergenic
1173087616 20:39939309-39939331 CAGGAAGGACAGCTTGGGGGTGG - Intergenic
1173737388 20:45372073-45372095 CCAGTAACACAGATTTGGGGAGG - Intronic
1173802205 20:45901300-45901322 CTAGAAAGACAAAATGGGCTGGG + Intronic
1173958052 20:47049872-47049894 AGAGAAAGACAGACTGGTGGCGG - Intronic
1175017802 20:55810561-55810583 CTGGAAAGATAGATTGGTGGTGG - Intergenic
1175386575 20:58599812-58599834 CTAAAAACACAGATTAGGGCCGG + Intergenic
1177977892 21:27873208-27873230 CTTGAACCAGAGATTGGGGGGGG - Intergenic
1178041973 21:28649299-28649321 CTAGAAGGAAAGAATGAGGGTGG + Intergenic
1181902490 22:26168317-26168339 CTAGAAAGAATGGGTGGGGGAGG - Intergenic
1181999048 22:26905121-26905143 AGAGAAAGACAGTTGGGGGGAGG + Intergenic
1183078166 22:35439657-35439679 CCTAAAAGACAGAGTGGGGGTGG - Intergenic
1183170297 22:36182917-36182939 CTAGAAACAGAGAGTGGGGCAGG - Intergenic
1183437193 22:37802955-37802977 TTAGAAGGATGGATTGGGGGCGG - Intergenic
1184877950 22:47287231-47287253 AAAGAAAAACAGAATGGGGGAGG - Intergenic
949458378 3:4263486-4263508 CTAGAGAGACAGATTGGGGCTGG - Intronic
950933264 3:16812051-16812073 ACAGAGAGACACATTGGGGGTGG - Intronic
950939351 3:16877805-16877827 CTAGAAAGGAAGATTGGGCCAGG + Intronic
951077751 3:18417122-18417144 TCAGAAATACAGCTTGGGGGTGG + Intronic
951125118 3:18975539-18975561 ATAGAAAGAGAGACTGGGGTAGG - Intergenic
951142264 3:19177491-19177513 GTAGAAGTACAGAATGGGGGAGG - Intronic
953140230 3:40222573-40222595 TCAGAAAGACAGATGGGGAGGGG - Intronic
956467118 3:69530126-69530148 CTACAAAGACAGAATTGAGGAGG + Intronic
957594471 3:82244508-82244530 CAAGGAAGATAGATTGGAGGAGG - Intergenic
957690346 3:83558159-83558181 CGAGAAAGAAAGATTGGGGGTGG + Intergenic
958125064 3:89345510-89345532 ATAGAAAGAGAGATGGGGGTGGG - Intronic
961640840 3:128363963-128363985 CTAGGAACAGAGCTTGGGGGAGG + Intronic
961986895 3:131144389-131144411 ATACAAAAGCAGATTGGGGGTGG - Intronic
964689765 3:159437302-159437324 CCAGATAGACAAAATGGGGGAGG - Intronic
966485841 3:180468887-180468909 TTAGAAACAAAGAATGGGGGTGG + Intergenic
966534496 3:181016709-181016731 CTAGAAAGACATGTTGGGGCCGG + Intergenic
966880740 3:184349034-184349056 CTATAAAGACAGGCTGGGGTTGG - Intronic
968320853 3:197766949-197766971 CTAGAAAGACAGAATGTCAGTGG + Intronic
969143480 4:5100352-5100374 CAAGAAAGGCAGCTGGGGGGAGG - Intronic
969235780 4:5864427-5864449 TCAGGAAGGCAGATTGGGGGTGG - Intronic
969842622 4:9893523-9893545 TGAGAAAGAGAGATAGGGGGAGG + Intronic
971410532 4:26366708-26366730 TTACCAAGACAGACTGGGGGCGG - Intronic
971589059 4:28443559-28443581 CTGGAAAGCCAGATTTGAGGGGG + Intergenic
973767443 4:54176059-54176081 CTAGAAGGACAGATGGAGAGAGG + Intronic
973899685 4:55456063-55456085 CTAGAAATAAACTTTGGGGGGGG + Intronic
974355127 4:60802650-60802672 TTAGAAAGACAGGTTGAGGGAGG - Intergenic
974842977 4:67319326-67319348 ATAGATAGACAGATAAGGGGAGG - Intergenic
975215426 4:71748320-71748342 CAAGAAAGACAGGTGGTGGGGGG + Intronic
976619147 4:87110856-87110878 CTGGGAGGGCAGATTGGGGGTGG + Intronic
976810231 4:89092357-89092379 CAAAAAAGAAAGGTTGGGGGAGG + Intronic
977931215 4:102751225-102751247 TTAGAAAGAATGATTGTGGGTGG + Intronic
978230396 4:106390749-106390771 CCAGAAAGACAGATGTGGGTGGG - Intergenic
978636832 4:110819759-110819781 CTAGAAAGTCAAATTGGCAGTGG + Intergenic
980000388 4:127480690-127480712 CTAGAGATCCAGATTGGGGAAGG - Intergenic
980136383 4:128862510-128862532 CTAGAATGAAGGAATGGGGGTGG - Intronic
982533714 4:156581229-156581251 CTAAAAAGACAGATGCGGGGAGG - Intergenic
986340527 5:6785298-6785320 TTAGAAAACCAGATTGGTGGGGG + Intergenic
987356169 5:17065094-17065116 CTAGAAAGCCAGATTATAGGCGG + Intergenic
988174810 5:27708461-27708483 CTGGAAAGACATTTTGGGGAGGG + Intergenic
990229139 5:53691625-53691647 GTAGAGACAGAGATTGGGGGTGG - Intergenic
991588563 5:68224916-68224938 CTATAAAGACAGCTTGATGGAGG - Intronic
993903567 5:93600511-93600533 CTGGAAAGAAAGCTTAGGGGAGG - Intergenic
994700878 5:103133456-103133478 CCAGAAAGGCAGATTGTGGTTGG + Exonic
994745537 5:103673642-103673664 CTAGAGAGGTAGATTGGAGGAGG + Intergenic
994856651 5:105130280-105130302 ACAGCAAGAAAGATTGGGGGTGG + Intergenic
994935770 5:106251568-106251590 AGAGAAAAACAGATTGGGGAGGG - Intergenic
995402311 5:111757215-111757237 CTAGAAAGACAGATTGGGGGGGG + Intronic
996055857 5:118981680-118981702 TTAGAAAGGCAGATTCGGGGAGG - Intronic
998113932 5:139522407-139522429 GGAGAAAGAAAGACTGGGGGAGG + Intergenic
998394190 5:141807727-141807749 CAAGAAACACAGAATTGGGGAGG - Intergenic
999795086 5:154981706-154981728 ACAGAAACACAGAGTGGGGGAGG + Intergenic
1000197015 5:158969465-158969487 CTAGAAAGACTGCTAGGGGCCGG + Intronic
1000322791 5:160148247-160148269 CTAAAAATACAGATTGGGCACGG - Intergenic
1000458139 5:161478607-161478629 CTTGAAAGAGATATTGGGAGAGG + Intronic
1001573264 5:172744692-172744714 CCAGAAAGGCAGGTCGGGGGGGG - Intergenic
1001873815 5:175182050-175182072 TCAGAAGAACAGATTGGGGGAGG - Intergenic
1003497062 6:6673422-6673444 CTAGACAGACAGATGGGGCAGGG - Intergenic
1003598484 6:7496277-7496299 ATAGAAAGACAGAATGGGCTGGG + Intergenic
1003867212 6:10374327-10374349 CTAGAAGGGCAGTTTGGGGTAGG + Intergenic
1005105805 6:22223130-22223152 CTTGGAAAACAGATTGGGTGGGG + Intergenic
1005436184 6:25814686-25814708 CTAAAAAGACAGAATGGGCTGGG + Intronic
1005585530 6:27273014-27273036 GTAGAGAGAGAGCTTGGGGGAGG - Intergenic
1005645625 6:27835136-27835158 CTTGAAAAACAGTTTGAGGGAGG - Intergenic
1007378441 6:41471609-41471631 CAAGAGAGACAGATAGGGGTGGG + Intergenic
1008006227 6:46412400-46412422 CTAGAGGTACAGATTGTGGGGGG + Intronic
1008662446 6:53681988-53682010 ATAGAAAGACAGCTTGTGAGGGG + Intergenic
1009313759 6:62191010-62191032 TTAGAAAGACAGCTTGGATGTGG - Intronic
1009476888 6:64103592-64103614 CTAGAAAGAGAGGTAGGAGGAGG + Intronic
1009748852 6:67856899-67856921 AGAGGAAGACAGAGTGGGGGAGG - Intergenic
1010331169 6:74625999-74626021 CTATAAAAACAGATTAGAGGAGG + Intergenic
1010706452 6:79117534-79117556 CTTAAAAGAAAGATTGGGGCAGG + Intergenic
1010919289 6:81662030-81662052 TATGAAAGACAGATTGGGGTGGG + Intronic
1011614482 6:89185320-89185342 GTAGAAAGCCAGTTTGGTGGTGG + Exonic
1011861821 6:91767564-91767586 CTGAAAACACAGATTGGGGCAGG + Intergenic
1016879629 6:148898137-148898159 CTAGCAAGACAGAATGAGGCTGG + Intronic
1017020164 6:150133599-150133621 CTAGAATGGAAGGTTGGGGGTGG + Intergenic
1018254611 6:161905580-161905602 CCAGAAAGACAGCTTGGAAGCGG - Intronic
1018447320 6:163869696-163869718 GTAGAGAGAGAAATTGGGGGAGG - Intergenic
1018528412 6:164737586-164737608 CTAGGAAGACAGATTTATGGAGG - Intergenic
1019473210 7:1232125-1232147 CTACAAAGACAGAGGTGGGGGGG - Intergenic
1020929385 7:14374057-14374079 CTAGAGAGAGAGATTGGAAGAGG - Intronic
1022015367 7:26344759-26344781 TTGGAAAGACAGACTGGGGTTGG - Intronic
1022589078 7:31643704-31643726 CTAGAGAGACGGATTTGGTGAGG - Exonic
1024309497 7:47956396-47956418 TTAGAAACAAAGAATGGGGGTGG + Intronic
1024717627 7:52098834-52098856 CTAGAAACACAGGTTGGTGAGGG - Intergenic
1027498081 7:78912967-78912989 AGAGAAATACAGTTTGGGGGTGG + Intronic
1032725541 7:134587109-134587131 AGAGAGAGACAGAGTGGGGGGGG + Intergenic
1033711415 7:143950371-143950393 CAAGAGAGAGAGATTGCGGGTGG + Intergenic
1034490562 7:151391094-151391116 CTAGAAAGGCAGATCGTGAGCGG + Intronic
1034532538 7:151705539-151705561 TTAGGGAGACAGATAGGGGGAGG + Intronic
1034923602 7:155103341-155103363 CTAGGAAGAAAGATTGAGGGAGG + Intergenic
1036243482 8:7097653-7097675 CTAGAAAGGCAGATTTGGGCTGG + Intergenic
1036898349 8:12653776-12653798 CTAGGAAGGCAGATTTGGGCTGG - Intergenic
1037623467 8:20587592-20587614 CTACAGAGACAGGGTGGGGGGGG + Intergenic
1038720984 8:30035102-30035124 ATAGAAACACAGATTGGGGCGGG - Intergenic
1038864562 8:31425596-31425618 CTCAAAAGACAGAGGGGGGGAGG - Intergenic
1039337506 8:36608151-36608173 GGAGAGAAACAGATTGGGGGTGG - Intergenic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1041275820 8:56156771-56156793 TTAGAAAGACTGGTTGGGCGGGG - Intergenic
1043445560 8:80316208-80316230 CTAAAAATACAAATTGGGTGGGG - Intergenic
1043956767 8:86369478-86369500 AGAGAAAAATAGATTGGGGGTGG + Intronic
1044836286 8:96298608-96298630 CAAGAAAGACATATTGGAGGGGG - Intronic
1044850666 8:96424308-96424330 AAAGAAAGCCAGATTGGAGGGGG + Intergenic
1044899832 8:96932589-96932611 CTGGAAAGGCAGTTTGGGGCTGG - Intronic
1046009922 8:108533946-108533968 GTAGTAAGACAGGTTAGGGGAGG - Intergenic
1047243314 8:123114745-123114767 CTAGCAAGTCAAATTGGGGCTGG - Intronic
1047717371 8:127607929-127607951 TAAGAAAGAAAGATTGGGGTAGG + Intergenic
1048312415 8:133335818-133335840 CTAGCAAGAGAGAGAGGGGGAGG + Intergenic
1049097795 8:140558983-140559005 CAAGAAACTCAGATTGGGGGGGG - Intronic
1049155314 8:141062628-141062650 GTAGATAGACAGATGGGGGAGGG + Intergenic
1049519490 8:143080732-143080754 TTAGAAAGAGAGATTGGAAGGGG + Intronic
1050974545 9:11920685-11920707 CTATAAAAACAGACTGGGTGTGG + Intergenic
1055565856 9:77568031-77568053 CTAGAAAGAAAGAGGTGGGGTGG + Intronic
1055592750 9:77834809-77834831 TTTAAAAGACAGATTGGGAGTGG - Intronic
1056197062 9:84239097-84239119 GTAGATAGACAGATAGGGGCAGG - Intergenic
1056734646 9:89198431-89198453 TTAGAAACTCAGAATGGGGGAGG + Intergenic
1056777470 9:89524144-89524166 CCAGACAGACAGATAGGAGGAGG + Intergenic
1056804993 9:89721623-89721645 CTTGCAAGACAGATGGGGTGAGG + Intergenic
1057509623 9:95666606-95666628 GGAGAAAGACAGAGAGGGGGAGG - Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058144074 9:101391136-101391158 CCAGAAAGGTAGATTGGGGTGGG - Intronic
1060998071 9:127886153-127886175 CCAGAAAGAGAGATTGTGTGGGG - Exonic
1188882742 X:35510116-35510138 CTAGAAGAATAGAATGGGGGTGG + Intergenic
1190723593 X:53171683-53171705 CAAGAAAGACAGGATGGGGCCGG + Intergenic
1191839074 X:65497315-65497337 CTGGAAAGATAGTTTGGGGATGG + Intronic
1192552188 X:72063231-72063253 ATAGAAAGTGAGTTTGGGGGAGG - Intergenic
1192682253 X:73264015-73264037 CTTTAAAGATAGATTGGGAGGGG + Intergenic
1192985992 X:76398819-76398841 TTAGAAAGAAAGAATGGGGGTGG + Intergenic
1197290715 X:124653899-124653921 CTTGAAAGACAGATGGGGTGGGG - Intronic
1197684889 X:129428297-129428319 CTAAAAAGACAGTCTGGAGGGGG - Intergenic
1200898562 Y:8403542-8403564 CTAGAAAGAGAGAGAGGAGGAGG - Intergenic