ID: 995402709

View in Genome Browser
Species Human (GRCh38)
Location 5:111759758-111759780
Sequence CTATAGCTACAGTTTGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995402709 Original CRISPR CTATAGCTACAGTTTGAGTG AGG (reversed) Intronic
900072620 1:785184-785206 CTATTGATAAAATTTGAGTGGGG + Intergenic
918133465 1:181648733-181648755 ATTGAGCTACAGTTTGAGGGTGG - Intronic
921631015 1:217433684-217433706 GTATATGTACAGTTTGGGTGTGG - Intronic
921649571 1:217660622-217660644 TTAAAGCTTCAGTTTGGGTGTGG - Intronic
922268204 1:224008109-224008131 CTATTGATAAAATTTGAGTGGGG + Intergenic
1064095469 10:12421433-12421455 CCATAGCTGCTGTTTCAGTGTGG + Intronic
1067176567 10:43953922-43953944 CTAGAGCTACAGTTTCAGCCAGG - Intergenic
1071181432 10:82988902-82988924 TGACAGCTACAATTTGAGTGAGG + Intergenic
1073313790 10:102563823-102563845 CTCTAGCTGCATTTTGAGAGTGG + Intronic
1076261987 10:129074116-129074138 ATATATGTACATTTTGAGTGAGG + Intergenic
1081114427 11:39181843-39181865 CAATAGCTTCTGTTTGAGGGAGG + Intergenic
1081455334 11:43216373-43216395 CTCCAGTTACAGTTTGATTGTGG - Intergenic
1083002948 11:59313478-59313500 CTATAGCTACAATTTATGTTGGG - Intergenic
1083331711 11:61901484-61901506 CTAGAGTTCCAGTTAGAGTGCGG - Intronic
1085953100 11:81357090-81357112 CTATAGGAAGAGTATGAGTGTGG - Intergenic
1089530700 11:119126981-119127003 CTGTGGCTACAGTGTGAGTGGGG + Exonic
1095042183 12:37455483-37455505 CTACAGCTACAGCTTCAGTTTGG - Intergenic
1097361006 12:58657630-58657652 CAATAGCTTCAGTATAAGTGGGG - Intronic
1097877951 12:64661106-64661128 CTACGGCTACCATTTGAGTGAGG - Intronic
1105674335 13:22654221-22654243 TTATAGCTTCAGTTTAAGAGGGG - Intergenic
1106944708 13:34814341-34814363 CTAGTGCTATATTTTGAGTGAGG + Intergenic
1107261259 13:38494188-38494210 CTGGAGCTGCAGTTTGAATGAGG - Intergenic
1110005930 13:70268998-70269020 CTATAGCTACAGTTCCTGTTTGG - Intergenic
1115338906 14:32271395-32271417 CAATAGCTCCACTTTGGGTGGGG - Intergenic
1119729750 14:76943487-76943509 CTGCAGCTACCGTTTTAGTGTGG - Intergenic
1125329256 15:38565570-38565592 CAATAGCTAATGATTGAGTGCGG + Intronic
1127014053 15:54663503-54663525 CTATAGGTACAATTTAAATGTGG + Intergenic
1132403331 15:101527218-101527240 CCATAGCGACAGTTTGAGGCCGG + Intergenic
1148234716 17:45961058-45961080 CTTTAGCTGCAGGTTGAATGGGG + Intronic
1161732562 19:5970349-5970371 TTAAAGCCACAGTCTGAGTGGGG - Intronic
1167316004 19:48763065-48763087 CTATAGCCAATGCTTGAGTGTGG - Intergenic
927097216 2:19756600-19756622 CTATAACTACAGTTTCCATGAGG - Intergenic
927229261 2:20803723-20803745 CTATAGCCACACTTTCAATGAGG + Intronic
931245471 2:60489149-60489171 CTAAAGCAACAGTTTAATTGGGG - Intronic
933336595 2:80967131-80967153 CTACAGCTACAGTTTCTCTGGGG + Intergenic
937382011 2:121386964-121386986 ATACAGTTACAATTTGAGTGAGG + Intronic
938980685 2:136523474-136523496 CTATAGCTACTGTTTCATTAGGG - Intergenic
939409905 2:141811624-141811646 AAATAGCTATAGTTTGAGTATGG - Intronic
939978665 2:148751754-148751776 GTATAGCATCAATTTGAGTGGGG - Intronic
942984011 2:182117408-182117430 GCATAGCTACTGTATGAGTGTGG - Intronic
943127244 2:183809866-183809888 CTAGAGCTAATGTTTGAATGTGG + Intergenic
1171804489 20:29662602-29662624 CTACAGCTACAGCTGCAGTGTGG + Intergenic
950179909 3:10904155-10904177 CTGTAGCTAAAGTGTGGGTGGGG + Intronic
952611098 3:35210689-35210711 ATATGGCTAGAGTTGGAGTGAGG + Intergenic
953645790 3:44752884-44752906 CAATAGCTCCACTTTGGGTGGGG - Exonic
964407676 3:156366537-156366559 CTATGGCTACCTTTTCAGTGGGG - Intronic
964925425 3:161950615-161950637 CTATAGTTACAGTTTTAGGATGG + Intergenic
967473104 3:189885968-189885990 CCTTAGCTGCAGTTTGAGGGTGG + Intronic
967514437 3:190349858-190349880 ATATACCTGCAGTTTGACTGGGG - Intronic
970794142 4:19891729-19891751 CTAGAGTGACAGCTTGAGTGAGG - Intergenic
973188443 4:47358864-47358886 ATATATCTATAGTTTGTGTGGGG + Intronic
974799808 4:66802068-66802090 CTAATGCTACAGACTGAGTGGGG - Intergenic
975627548 4:76364786-76364808 CTATAGCAGCAGTTTAACTGTGG + Intronic
976947288 4:90786053-90786075 CCGTAGCTACAGTCTGAATGGGG + Intronic
978964669 4:114725941-114725963 CCACAGCTGCAGTTTGGGTGGGG + Intergenic
989218122 5:38926237-38926259 CTACAGCTGCAGCTTCAGTGAGG - Intronic
992021179 5:72625735-72625757 AGATATCTACAGGTTGAGTGAGG + Intergenic
992238155 5:74734005-74734027 CTTTAGCTACACTTTGTCTGTGG - Intronic
995402709 5:111759758-111759780 CTATAGCTACAGTTTGAGTGAGG - Intronic
996142271 5:119926433-119926455 CTATGGCCACAGTGTGATTGAGG + Intergenic
999897034 5:156045840-156045862 CTGTGGCTACAGTTGGAGGGGGG - Intronic
1000729314 5:164811796-164811818 CAATAGCTACAATTGGATTGAGG + Intergenic
1003020874 6:2508346-2508368 CAATGGCTACAGGTGGAGTGGGG + Intergenic
1003314970 6:5003870-5003892 CTATAACTACAGGGTGAGTCCGG - Exonic
1003383497 6:5646566-5646588 CTATAACTACAGTTGGACTTTGG + Intronic
1003518225 6:6835286-6835308 CTATAGATACAGATAGAGTGGGG - Intergenic
1007686497 6:43670195-43670217 GTCTAGCTAAAGGTTGAGTGGGG - Intronic
1012177741 6:96109928-96109950 CTATAGCTACAGGTATACTGGGG + Intronic
1015394408 6:132718480-132718502 CCATACTAACAGTTTGAGTGGGG + Intergenic
1017769064 6:157631066-157631088 GTGTAGCTAGAGTGTGAGTGTGG - Intronic
1022940555 7:35233068-35233090 CTATAGATATACTTTGACTGGGG - Intronic
1029298770 7:99562008-99562030 CTATTGCTACTGATGGAGTGTGG + Intronic
1031735633 7:125356759-125356781 CTATAGCTACTATTTTAGTGTGG - Intergenic
1033792778 7:144811988-144812010 TCATAGCTACAGTTTTTGTGTGG - Intronic
1036466942 8:9006944-9006966 CTATAATTACAGTTTACGTGAGG + Intronic
1036691236 8:10946088-10946110 CTTTAGCTCTAATTTGAGTGAGG - Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040693632 8:49969861-49969883 CTATAACAGCATTTTGAGTGTGG - Intronic
1044921376 8:97172927-97172949 CTAAAGGAACAGTTTGAGTTAGG - Intergenic
1046324517 8:112623180-112623202 CTATACCTACAGTTGAATTGGGG + Intronic
1046726475 8:117679957-117679979 CAATAGCTAAAGCATGAGTGAGG + Intergenic
1047073371 8:121372788-121372810 CTAAAGCTAATGTTTGAGGGAGG - Intergenic
1049969295 9:807541-807563 CTCTAGCTTTAGTTTGCGTGTGG + Intergenic
1052847816 9:33352646-33352668 GTAGAGCTACAGTGTGAATGTGG + Exonic
1052894027 9:33730885-33730907 CTAGAGTTACAGTTTAAGAGAGG - Intergenic
1053179797 9:35958933-35958955 CGATAACTATAGTTAGAGTGTGG - Intergenic
1056045221 9:82707735-82707757 CTTCAGCTACTGCTTGAGTGGGG - Intergenic
1060954303 9:127627399-127627421 CAAGAGCTAAAGTTAGAGTGAGG + Intronic
1061528967 9:131194955-131194977 CTGTAGCAGAAGTTTGAGTGGGG - Intronic
1190211387 X:48451340-48451362 TTGTAGCATCAGTTTGAGTGAGG - Intergenic
1199738024 X:150703490-150703512 ATATAGCTACTGTGTGTGTGTGG - Intronic
1201400874 Y:13602583-13602605 CTGTAGCAACAGTTTCAGGGGGG + Intergenic