ID: 995404874

View in Genome Browser
Species Human (GRCh38)
Location 5:111783600-111783622
Sequence AAACTTCCTCAGATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 338}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995404874_995404877 -4 Left 995404874 5:111783600-111783622 CCCTTCTCCATCTGAGGAAGTTT 0: 1
1: 0
2: 1
3: 35
4: 338
Right 995404877 5:111783619-111783641 GTTTCCTACTATTCCTAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995404874 Original CRISPR AAACTTCCTCAGATGGAGAA GGG (reversed) Intronic
901369599 1:8785530-8785552 GAAATTCCTCTGTTGGAGAATGG - Intronic
902827786 1:18988931-18988953 TCACTTCCTCATATGGAGAGTGG + Intergenic
902982526 1:20135795-20135817 GAACTTCCCCAGCTTGAGAAAGG - Intergenic
904615860 1:31749248-31749270 AGACTTCCTCAGCTGGGGAGTGG - Intronic
905094664 1:35459211-35459233 AAACTTGAACAGATTGAGAAGGG + Intronic
907020486 1:51061600-51061622 AAACTTCCTCAGCCTGATAAAGG - Intergenic
907159597 1:52360601-52360623 CAGCTTCCGCAGAGGGAGAATGG - Intronic
907428113 1:54394078-54394100 CAACTTCCTCGGGTGGAAAATGG - Intronic
909314202 1:74195368-74195390 CAACTTCCTCATATAAAGAAGGG + Intronic
910934560 1:92476611-92476633 AAACTTCCTCTGAATTAGAACGG - Intronic
912861947 1:113221157-113221179 AAAATTCTTCTGAAGGAGAAGGG - Intergenic
914827272 1:151145363-151145385 CACCTTCCTCAGAGGGAGCAGGG + Intronic
914857110 1:151360748-151360770 AAACTTCTTCAGAATGAGAAAGG - Intergenic
915127101 1:153673426-153673448 AAACTACCTAAAATGAAGAATGG - Intergenic
915293399 1:154901727-154901749 AAACTCCCACAAATGCAGAAAGG + Intergenic
915808267 1:158877389-158877411 AAACTTCCTCATAAGGAGTTAGG - Intergenic
917565128 1:176206126-176206148 AAGCTTCCTCGGATGCAGAGGGG - Intronic
918003829 1:180523516-180523538 AGAGGTCCTCAGATGGACAATGG - Intergenic
919323546 1:196075366-196075388 ATAGTTCCTCAGTTGAAGAATGG + Intergenic
919889288 1:201958869-201958891 AAATTTCCTCATCTGGAAAATGG - Intronic
919945366 1:202315300-202315322 AATCTTCCTGGGATGGAGCAGGG - Intronic
920128677 1:203713839-203713861 AAACTTCCTCATTTGTAAAATGG - Intronic
921388494 1:214595748-214595770 AAACTTCCTCAGTCTGATAAAGG + Intergenic
921434317 1:215099824-215099846 ACACTTCCTTAGAGGAAGAAGGG + Intronic
922925948 1:229346717-229346739 CATCTTCCTCTGATGGAGATTGG - Intergenic
923008909 1:230072945-230072967 AGACTTACTCAGAGGGAAAAGGG - Intronic
923284826 1:232483631-232483653 AGATTTCCTCAGATGAACAAAGG - Intronic
924906469 1:248458501-248458523 AAACTACTTCAAAGGGAGAAAGG + Intergenic
1063604706 10:7512544-7512566 CAGCTTCCTCAGAGGGATAAGGG + Intergenic
1063691295 10:8290008-8290030 AATCTTCCTGATATGGAGACAGG - Intergenic
1064823770 10:19371358-19371380 AAACTTCCTCATACTGATAAAGG - Intronic
1065497620 10:26345888-26345910 AAACTGCCTCATCAGGAGAATGG + Intergenic
1070875418 10:79802101-79802123 AAACTTCCTAACATGCTGAATGG - Intergenic
1071642347 10:87324243-87324265 AAACTTCCTAACATGCTGAATGG - Intergenic
1072852497 10:98910926-98910948 AAATTTCCTCAGATAGAGGGTGG - Intronic
1073409307 10:103326554-103326576 AAAATTCCTCAGAAGAAAAATGG - Exonic
1074058413 10:109943092-109943114 AAACTTCCAATCATGGAGAAAGG + Intronic
1074143034 10:110692910-110692932 AAACTTCCTCAGCATGATAAAGG - Intronic
1076243862 10:128931276-128931298 AAACTTCCTCCAGTGGTGAAAGG - Intergenic
1077063927 11:630311-630333 AAACGTCCTCAGCAGGTGAATGG - Intergenic
1078259280 11:9689684-9689706 CAGCTTCCTCATCTGGAGAAGGG + Intronic
1078274761 11:9833103-9833125 AGACTGCCTGAGATGGTGAAAGG + Intronic
1078606400 11:12780081-12780103 AAAATTACTCAGATTGGGAAGGG + Intronic
1079060501 11:17244628-17244650 AAACTTTCTCAAAGGAAGAAGGG - Intronic
1080332384 11:31154160-31154182 AAACTTACTATCATGGAGAAAGG - Intronic
1082926674 11:58554718-58554740 AAAATTCCTAAGTGGGAGAATGG + Intronic
1083426438 11:62589911-62589933 CAACTTCCTCAGATATAAAATGG + Intronic
1084775934 11:71375527-71375549 AAATTTGCCCAGAAGGAGAAAGG + Intergenic
1085113466 11:73909362-73909384 AAACTCCCTAAGATGGAGGATGG - Intronic
1085579031 11:77634335-77634357 TCACTCCCTCAGATGAAGAACGG + Intronic
1086273988 11:85102626-85102648 GAACTTCCTCAGCTTGATAAAGG + Intronic
1086343152 11:85867992-85868014 ATCCTTCCTCAGATGGTGAGAGG - Intronic
1087952023 11:104233011-104233033 AAACTTCCTCAATCGGATAAAGG - Intergenic
1088076453 11:105854826-105854848 AAAGTCCCTAAGCTGGAGAATGG + Intronic
1088879413 11:113961892-113961914 AAACTTCCACTGATGGTGGAGGG + Intergenic
1088919810 11:114252647-114252669 CAACTTTCTCAGAGAGAGAAAGG - Intergenic
1088932274 11:114364240-114364262 ACACCTCCTGAGATGGGGAAGGG - Intergenic
1089851898 11:121504839-121504861 AACCTTCCTCAAATTGATAAAGG - Intronic
1089867590 11:121645403-121645425 ACTCTTCCTCAAATGGAAAAAGG + Intergenic
1089908787 11:122074453-122074475 AAACTTGGACAGATGGAGATGGG - Intergenic
1090222762 11:125044613-125044635 AAACTTCCTCAACTTGAAAAAGG - Intergenic
1091024510 11:132130113-132130135 AAATATTCTCAGAAGGAGAAGGG + Intronic
1091792106 12:3277852-3277874 AATTTCCCACAGATGGAGAAAGG - Intronic
1091911518 12:4234237-4234259 AAATTTCCTCATCTGGAAAAGGG + Intergenic
1092989734 12:13884741-13884763 GAACTTCCTCAGCTTGACAAAGG - Intronic
1096673711 12:53215089-53215111 AAGCTCCCTGAGAGGGAGAATGG + Intronic
1099109420 12:78538865-78538887 AAACCATCTCAGAAGGAGAATGG + Intergenic
1099198873 12:79652147-79652169 AAACTTCTGGAGATGGATAATGG + Intronic
1100093981 12:91008538-91008560 ACAGTTTCTCAGATGCAGAATGG - Intergenic
1100569732 12:95836779-95836801 AAACTTACTCAGATGCAGAAGGG + Intergenic
1100891954 12:99135500-99135522 AAACTTCCAGAGAGGGAGAAAGG + Intronic
1101623104 12:106409555-106409577 AAACTTCCTTTGAAGGAAAATGG + Intronic
1102714856 12:114961435-114961457 CAACTTCCTCAAATGTAAAATGG - Intergenic
1102991606 12:117320197-117320219 ATGTTTCCTTAGATGGAGAAAGG + Intronic
1103053622 12:117801783-117801805 AAACCATATCAGATGGAGAAGGG + Intronic
1103151642 12:118645223-118645245 AATCTTCCTCAGAGGGAGTTTGG - Intergenic
1105323557 13:19349577-19349599 AGCCTTCCTCAAATGGAGTATGG + Intergenic
1105870397 13:24499924-24499946 AGCCTTCCTCAAATGGAGTATGG - Intronic
1106610657 13:31276317-31276339 AATCTTCACCAGCTGGAGAAAGG + Intronic
1106887311 13:34201974-34201996 AAACTTCCTCTGAAGGAAGAAGG + Intergenic
1107424552 13:40280218-40280240 AAATTTCCTCATCTGTAGAATGG + Intergenic
1107926493 13:45267670-45267692 AAACTTTCTCAGAGGAAGATAGG - Intronic
1108485346 13:50917946-50917968 AAACATACTGAGATGGAGCATGG - Intronic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1109240930 13:59887044-59887066 AAACTTCCTCATTTTGATAAAGG - Intronic
1109274695 13:60290665-60290687 GCTCTTCCTCAGGTGGAGAAGGG + Intergenic
1110623813 13:77629213-77629235 AAACTTCTTCAGGTCAAGAATGG - Intronic
1111366947 13:87259899-87259921 AAACTTCCTCAACTTGATAAAGG + Intergenic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1111903343 13:94227012-94227034 AAACTTCTTCAGCTGTAAAATGG + Intronic
1111971434 13:94921320-94921342 TAGACTCCTCAGATGGAGAAGGG + Intergenic
1112852990 13:103729656-103729678 AAACTTCCTCAGACCCAGAGAGG + Intergenic
1113040939 13:106103417-106103439 AAAGTTTCTCAGATTGGGAATGG - Intergenic
1113667971 13:112154074-112154096 GAAGCTTCTCAGATGGAGAAAGG - Intergenic
1114541119 14:23460039-23460061 AAACTTCCTCAGCCTGATAAAGG + Intergenic
1114998499 14:28390782-28390804 AAACTCCATCAGATTGACAAAGG - Intergenic
1115835020 14:37392670-37392692 AAACTTTCTCACAGGGATAAAGG - Intronic
1115979248 14:39030804-39030826 ATGCGTCCTCACATGGAGAAAGG - Intergenic
1116360575 14:43991396-43991418 AAATTACCTTAGAAGGAGAATGG + Intergenic
1117368566 14:55054605-55054627 TAACTTCTACAGATGGAAAATGG + Intronic
1118323969 14:64769158-64769180 GCACTGCCTCAGATGGTGAAGGG - Intronic
1118616323 14:67576685-67576707 AAACTCCCCCAGATGCAGAGTGG - Intronic
1120508127 14:85378658-85378680 AAACTTCCTGAGCTCGATAATGG + Intergenic
1120612133 14:86655075-86655097 AAACTTCAAAAGAGGGAGAAAGG - Intergenic
1120806467 14:88756346-88756368 AAACTTCCTCAAACTGACAAAGG + Intronic
1121679745 14:95783643-95783665 AATGTTCCCAAGATGGAGAAAGG + Intergenic
1121979823 14:98444872-98444894 GAGCTTCCTGGGATGGAGAAGGG + Intergenic
1122167388 14:99838536-99838558 AAAATTATGCAGATGGAGAAGGG - Intronic
1122391609 14:101392056-101392078 TAACTTCTAGAGATGGAGAATGG - Intergenic
1122673142 14:103387358-103387380 AATCTATCTCAGGTGGAGAAAGG - Intronic
1122939959 14:104976851-104976873 CGACCTCCTCAGAGGGAGAAGGG - Intronic
1123452997 15:20385011-20385033 AAAAATCATCAGATGAAGAACGG - Intergenic
1125459159 15:39892151-39892173 AGACTTACTTAGATGAAGAAAGG + Intronic
1126563399 15:50069856-50069878 AAACTTGCTGAGATGAAGATGGG - Intronic
1126987038 15:54323879-54323901 CATCTTTCTCAGAGGGAGAAAGG - Intronic
1128345766 15:66851493-66851515 AAACTTTTTATGATGGAGAACGG + Intergenic
1128682526 15:69662231-69662253 CAAGTTCCTCAGAAGCAGAATGG + Intergenic
1133119377 16:3596780-3596802 AAAATGCCTCAGATGGAGCCCGG - Intronic
1134835752 16:17359190-17359212 AAGCTTCCTCTGATAGAGAATGG + Intronic
1135383201 16:22010611-22010633 AACGTTCCTAAGATGGAAAAGGG + Intronic
1135778923 16:25281767-25281789 CAGCTTCCTCACCTGGAGAATGG + Intergenic
1136156778 16:28388394-28388416 AGACTTCCGCAGGTGGAGCAGGG - Intronic
1136206308 16:28726887-28726909 AGACTTCCGCAGGTGGAGCAGGG + Intronic
1138593197 16:58014344-58014366 AATCTTCCTCTGATGGTGATTGG - Intronic
1141469021 16:84226014-84226036 GAACTTCCACAAAGGGAGAAAGG - Intronic
1141648384 16:85379386-85379408 AAACCTTGTCAGATGTAGAAGGG + Intergenic
1141758031 16:86006627-86006649 AAACTTCCTCAACTTGATAAGGG - Intergenic
1144267421 17:13584737-13584759 AAACTTCCTGAGATGAAAAGAGG - Intronic
1144301577 17:13926377-13926399 AGATTTCCTCAGTTGGAGCACGG - Intergenic
1144665716 17:17100956-17100978 AAATTTCCTCATCTGTAGAATGG + Intronic
1145242865 17:21249781-21249803 AACCGTCCTCAGATGGAGGCCGG + Intronic
1145407805 17:22622533-22622555 AAACTTCCTAACATGCTGAATGG - Intergenic
1146409488 17:32570283-32570305 AAACTTCCTTGGTTGTAGAATGG + Intronic
1146625182 17:34430015-34430037 AGAGTTGCTCTGATGGAGAATGG + Intergenic
1147529054 17:41256482-41256504 AAACTTTCCCAGTTGGAAAATGG - Intergenic
1148579010 17:48730092-48730114 AAACTTCCTTACAAGGAAAAGGG + Intergenic
1150528554 17:65952505-65952527 AATATTCCTCAGAAGGTGAAAGG - Intronic
1150672514 17:67214035-67214057 TAACTTCTTCAGATGGGGGAAGG + Intronic
1151069124 17:71188158-71188180 AAATTTACTCAGATGCAAAATGG - Intergenic
1152427887 17:80228521-80228543 AAACTGCTTCAGGTTGAGAACGG - Intronic
1155036782 18:22031166-22031188 GAACTTCCACAGTTGGACAACGG - Intergenic
1155331193 18:24718444-24718466 GAACTTCCTCAGCTGGATAAAGG - Intergenic
1155661405 18:28253266-28253288 AAACTTCCAATCATGGAGAAAGG - Intergenic
1155992426 18:32292693-32292715 AAACTTGCCCTCATGGAGAAAGG - Intronic
1156380097 18:36551063-36551085 AAACTTCCTCAACTTGATAAAGG - Intronic
1156393258 18:36673185-36673207 AAACTACCTAAGATGGAGATTGG + Intronic
1156399887 18:36730647-36730669 AAACTGCTGCAGATGGAAAAAGG + Exonic
1157279447 18:46335975-46335997 TGCCTTCCTCAGATGGAGACAGG - Intronic
1157848800 18:51029112-51029134 AAACTTGCCCAGCTTGAGAAAGG - Intronic
1158246504 18:55438516-55438538 AGACTTCATCCAATGGAGAAGGG - Intronic
1158599823 18:58847541-58847563 AAGCTTCCCCAGTTGGAGACTGG + Intergenic
1159637768 18:70826221-70826243 ATAGTTACTCAGATGGAGGATGG - Intergenic
1160161020 18:76470980-76471002 AAACTGCCTAGGAAGGAGAAAGG - Intronic
1161875941 19:6909644-6909666 AAAGTTCTTGAGATGGATAATGG - Intronic
1162622747 19:11857222-11857244 AAACTTTGTCCGATGGAGAGTGG + Intronic
1163143432 19:15364983-15365005 AAACTTCCCCAGCTGAAGAATGG + Intronic
1163551843 19:17969774-17969796 AAACTTCCCCAGCTGGGGATGGG - Intronic
1164584518 19:29458394-29458416 AAACTTCCAATCATGGAGAAAGG - Intergenic
1165957714 19:39512123-39512145 AAAGAGCCTGAGATGGAGAATGG - Intergenic
928102840 2:28449470-28449492 GAAGTTCCTGAGATGGTGAAGGG - Intergenic
930350028 2:50239551-50239573 AAATTTCCTCAGATATAGCATGG - Intronic
930537505 2:52662308-52662330 GAACTTCCTCAGCTTGATAAAGG + Intergenic
931025408 2:58108616-58108638 AGACTTCCACAGATGGAGACAGG - Intronic
934018110 2:87911885-87911907 AAAATTCATCTGATGGAGCATGG + Intergenic
935080863 2:99792625-99792647 AAACTTCCTCAGCTTGATAAAGG - Intronic
935400853 2:102658505-102658527 AAGCATCCCCAGATAGAGAATGG - Intronic
936707817 2:115096731-115096753 AACCTTCCTAAGTTGGAAAATGG + Intronic
937370456 2:121293921-121293943 AAACTTGCACAGCTGGAGGACGG + Intergenic
938410195 2:131057280-131057302 AATCTTCATCAACTGGAGAAAGG + Intronic
940971085 2:159897575-159897597 AAACTTGTGCAGATGGATAATGG + Intronic
941671037 2:168292586-168292608 AAACTGCCTTAAATGTAGAAGGG - Intergenic
941878136 2:170455515-170455537 TAACTTCCTCATATGTGGAATGG + Intronic
941946085 2:171098956-171098978 AAACTTCCTCAACCTGAGAAAGG + Intronic
943473493 2:188325669-188325691 AAACTACCTCAAAGGGAGATAGG - Intronic
943502116 2:188705247-188705269 AGACTTTCTCAGATTTAGAAAGG + Intergenic
943648839 2:190435068-190435090 ATTTTTCCTCAGATGGAGAGGGG - Intronic
947786215 2:232822995-232823017 AAACTTCTTCAGCTGGATAATGG - Intronic
1169551281 20:6704099-6704121 AATCTTCCTCAGTTGGCAAAGGG + Intergenic
1174551617 20:51366534-51366556 AAATCGACTCAGATGGAGAAAGG + Intergenic
1174729416 20:52900890-52900912 AAACATCCTCAACTGCAGAAAGG + Intergenic
1175152303 20:56944726-56944748 CAACTTCCTCATAGGGGGAAAGG - Intergenic
1175316396 20:58050563-58050585 AAACTTCTTCAACTGGATAAAGG + Intergenic
1175653107 20:60746031-60746053 AACCTTCCTCACATGGTGACAGG + Intergenic
1175970154 20:62682192-62682214 ACAGCTCTTCAGATGGAGAAGGG + Intronic
1176271709 20:64238855-64238877 AAACTCCCTCAGATGGACAGGGG - Intronic
1177070322 21:16497667-16497689 ATACTTCCTTAAAGGGAGAAGGG - Intergenic
1177399597 21:20585605-20585627 AAATTTCCTCAGTTTGAGAAAGG + Intergenic
1178139579 21:29667691-29667713 CAATTTCCTGAGCTGGAGAATGG - Intronic
1178164654 21:29959847-29959869 ACACTGGCTAAGATGGAGAAAGG - Intergenic
1179095643 21:38312248-38312270 AAAATACCTCAGAGGGAGCATGG - Intergenic
1179191781 21:39128699-39128721 AAAGTTCCAGAGATGGATAATGG - Intergenic
1181016487 22:20072217-20072239 AAGCATCTTCAGATGGAGTAGGG + Intergenic
1181318889 22:21989679-21989701 ACACGTCTTCAGATTGAGAAAGG - Intergenic
1181520004 22:23441122-23441144 GAACTTCCTCAGCCTGAGAAAGG - Intergenic
1181900368 22:26149741-26149763 GAACTTCCTCAGCTGGATAAAGG + Intergenic
1181996017 22:26883213-26883235 ATACTTCCTCAAATGCAAAATGG + Intergenic
1182358996 22:29735673-29735695 AAGATTCCTCAGATGCAAAATGG + Intronic
1182884997 22:33765855-33765877 TAACTTCTGCAGATGGAGAGAGG - Intronic
1184738895 22:46415677-46415699 AAAGTTCTTCAGGTGGAGAGTGG - Intronic
951076712 3:18402267-18402289 AAGATTCATCAGATGGGGAAAGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953560617 3:43988702-43988724 AAACTTCCCCAGATAAACAAAGG - Intergenic
953772506 3:45789476-45789498 AAACTTCCACAACTGGAGAATGG + Intronic
954380818 3:50218153-50218175 AGACTCCCTCAGATGCTGAATGG + Intronic
954494323 3:50939719-50939741 AAACTTCCTCAGCTTGATAAAGG + Intronic
955335265 3:58080296-58080318 ACACTTCCTCAGATGAACAGAGG - Intronic
955461182 3:59184949-59184971 ATACTTCCTCAGAGGTGGAATGG + Intergenic
956779558 3:72593411-72593433 AAACTCCTTCAGCTGTAGAATGG + Intergenic
957279233 3:78128348-78128370 AAACTTCTTCACATGGTGGAAGG + Intergenic
957546711 3:81647382-81647404 AAACATATTCAGATGGAGAAAGG - Intronic
959501592 3:107113076-107113098 AAGTTTCCTCAGGTGGACAAAGG - Intergenic
960327495 3:116315273-116315295 AAATTTCCTCAGATGCAATAGGG + Intronic
960500562 3:118432711-118432733 AAACTTCCTCAGAATTAAAATGG + Intergenic
960525652 3:118706720-118706742 AAACTGTCTCAGGTGAAGAAGGG + Intergenic
961147174 3:124603900-124603922 AAACTGCTTCAGATGGAGCCTGG + Intronic
962206563 3:133439858-133439880 GAACTTACTCAGATGCAGATTGG - Intronic
962498675 3:135966777-135966799 ATACTTCCTCAGATGTTGGAAGG - Intronic
963522695 3:146375242-146375264 CAACTGCCTCAGAAGGAGACAGG + Intergenic
964357963 3:155867904-155867926 AAACTTCCTCAACTTGATAAAGG + Intergenic
964659950 3:159109257-159109279 AAATTACCACAGTTGGAGAAAGG - Intronic
964822898 3:160793338-160793360 AAACTTGCTCATCTGAAGAAAGG - Intronic
965685746 3:171300410-171300432 AAATTTTCTCAGAAAGAGAAAGG + Intronic
965989737 3:174801641-174801663 AAACTTCCTCAAATTGATAAAGG - Intronic
966490591 3:180524119-180524141 GACCTTCCTCACATGGAGACAGG + Intergenic
967408468 3:189143260-189143282 AGACTTCCTCATCTGGAGAATGG - Intronic
968595783 4:1482492-1482514 GAACTTCCTCAACTTGAGAAAGG - Intergenic
968694340 4:2015006-2015028 AAACTTCCTTAAGTGGACAAAGG - Intronic
969270900 4:6100475-6100497 AAATGTCCTCAGTTGGTGAATGG - Intronic
970779270 4:19716255-19716277 AACCTTTCACAGATGGAGCAGGG - Intergenic
971554130 4:27990661-27990683 AAATTTCCTCAAATTGATAAGGG - Intergenic
971678063 4:29660129-29660151 AATCTTCCTCAAATGAAGCATGG + Intergenic
971796560 4:31236131-31236153 AAGCTTTCTGAGCTGGAGAATGG - Intergenic
974854592 4:67445075-67445097 GAACTTCCTCAAATTGATAAAGG + Intergenic
976768620 4:88625799-88625821 AAACTTCCTCAACTTGATAAAGG - Intronic
977129676 4:93219823-93219845 AATTTTTCTTAGATGGAGAAAGG - Intronic
978156718 4:105497702-105497724 AAACTTCCTCACATGATAAAGGG + Intergenic
981730827 4:147895892-147895914 AAACTTCCTCAAAATGAAAAGGG - Intronic
982501172 4:156157516-156157538 AAACTTCCTCAGACTGATAAAGG + Intergenic
983486120 4:168332793-168332815 AGACTTCCTGAGAGGTAGAAGGG + Intergenic
983769888 4:171536143-171536165 ATACTTCCTCAGTTTCAGAAGGG + Intergenic
984605243 4:181778429-181778451 AAACTTTCAGAGATGAAGAACGG + Intergenic
985624078 5:975686-975708 ATTCTTCCACTGATGGAGAAGGG - Intergenic
985624102 5:975890-975912 ATTCTTCCACTGATGGAGAAGGG - Intergenic
986045030 5:4028383-4028405 AAACTTCCCCAGAGGGAGGGTGG - Intergenic
986546740 5:8905989-8906011 AAACAACCTCTGAGGGAGAACGG - Intergenic
986950907 5:13083869-13083891 AAATTTACTCACATGGAGAAAGG + Intergenic
988017754 5:25581164-25581186 AAATTTCCTCATATGTAAAATGG - Intergenic
988342792 5:29996264-29996286 AAACTACCTCAGATGTGGAGAGG - Intergenic
988575059 5:32414367-32414389 AAACTTCCTCAGCTAGAAATTGG + Intronic
988904523 5:35772531-35772553 CTACGCCCTCAGATGGAGAAGGG - Intronic
990156961 5:52888408-52888430 AAAATTGCTCAGACGGGGAAGGG - Intronic
992546142 5:77815877-77815899 AATGTTCCTCAGAAGGTGAATGG + Intronic
992565703 5:77993482-77993504 AAATTTCCTAAGCTTGAGAAAGG + Intergenic
992938841 5:81741388-81741410 AAAGTTCTAGAGATGGAGAACGG + Intronic
992995233 5:82325835-82325857 AATCTTCTTATGATGGAGAAAGG - Intronic
993573029 5:89566650-89566672 AAACTTGCTTAGATGAAGCATGG + Intergenic
994813295 5:104550470-104550492 AAAATTCCTAAGATGGAGTGGGG + Intergenic
995404874 5:111783600-111783622 AAACTTCCTCAGATGGAGAAGGG - Intronic
995616584 5:113971254-113971276 AGATTTCATCAGATGAAGAAAGG - Intergenic
999356480 5:150938521-150938543 AAACTTCCTCAAACTGATAAAGG + Intergenic
1000689686 5:164301078-164301100 GAACATGCTCATATGGAGAAAGG + Intergenic
1000769595 5:165336268-165336290 TAAATTCCACAGATTGAGAATGG + Intergenic
1001117279 5:168950208-168950230 CTACTTCCTCACATGGAGGAAGG - Intronic
1001174438 5:169453085-169453107 AAACTTTCTCATTTGGATAAAGG - Intergenic
1002325376 5:178401550-178401572 AATATCCCTCAAATGGAGAATGG - Intronic
1002428069 5:179187389-179187411 AAAGTTCCTGAGGTGGAGACAGG - Intronic
1003273952 6:4632427-4632449 CAACTTCCTCATATGCAAAAGGG + Intergenic
1003573601 6:7271908-7271930 AACCTGTCTCAGATAGAGAACGG + Intronic
1004508936 6:16268772-16268794 AAAGTTCCAGAGATGGATAATGG + Intronic
1005032447 6:21523549-21523571 AAACCGCCTCTGATGGAGCACGG - Intergenic
1005532950 6:26726121-26726143 AAAATTCCTCAGATGAATAATGG + Intergenic
1005535501 6:26751872-26751894 AAAATTCCTCAGATGAATAATGG - Intergenic
1005537844 6:26775543-26775565 AAAATTCCTCAGATGAATAATGG - Intergenic
1006445270 6:34076508-34076530 AAGCTTCCTCAGCTGGAAAATGG + Intronic
1006929536 6:37679477-37679499 AAACTTCCCCAAAAGGAAAATGG + Intronic
1007729997 6:43939836-43939858 AAATTTCCTCAGAGGGGGCAGGG - Intergenic
1008409164 6:51153202-51153224 ACAATTCCTCAGAAAGAGAAAGG + Intergenic
1009006539 6:57795501-57795523 AAAATTCCTTAGATGAATAATGG - Intergenic
1009008712 6:57817951-57817973 AAAATTCCTCAGATGAATAATGG - Intergenic
1010231636 6:73540340-73540362 AAACTTTATCAGATACAGAAAGG + Intergenic
1010308490 6:74353349-74353371 AAACTTCATCTCCTGGAGAAGGG - Intergenic
1011164408 6:84430305-84430327 AAACAGTCTCACATGGAGAAAGG - Intergenic
1011722603 6:90174388-90174410 AAACTTCCTGAACTGGATAAAGG + Intronic
1012059025 6:94453661-94453683 AATCTTCCTCAGTGGGTGAATGG + Intergenic
1013912365 6:115292199-115292221 AAATTTCCTCATCTGGATAAAGG - Intergenic
1015107628 6:129555612-129555634 AAGCCTCCTCAGGAGGAGAATGG + Intergenic
1015871344 6:137779581-137779603 AATCTTTCTCAGAGGGAGATGGG - Intergenic
1016210412 6:141525973-141525995 AAACTTCCTCAACTTGATAAAGG + Intergenic
1016615037 6:146037950-146037972 AGAGTTGCTCAGATGCAGAAGGG - Intronic
1017612304 6:156201566-156201588 AAACATCCACTGATGGATAAAGG + Intergenic
1017684349 6:156896893-156896915 AAACTTCTTTAGAAGGAAAAAGG + Intronic
1017943504 6:159074871-159074893 AAACTTCCTTAAATTGACAAAGG - Intergenic
1018168204 6:161120422-161120444 GAACTTCCTCCAATGGAAAAAGG - Intergenic
1018442159 6:163823369-163823391 AAACTTCCAAACATAGAGAAGGG + Intergenic
1018775172 6:167008258-167008280 AAAATTCCACAGCTGGGGAAGGG - Intronic
1019591251 7:1835158-1835180 GAACTTCCTCAGCCTGAGAAAGG + Intronic
1019753756 7:2752282-2752304 AAACTTCCTCAGTTTGATAAAGG + Intronic
1020454360 7:8354328-8354350 AAAATTCTTCAGAGGGAGGATGG + Intergenic
1021055882 7:16045508-16045530 AAAATTTCTCAGCTAGAGAATGG - Intergenic
1023165664 7:37341160-37341182 AAAGCTCCACAGATTGAGAAGGG + Intronic
1024039070 7:45535511-45535533 AGACTTTCTCAGGTGGAGAGTGG + Intergenic
1025818246 7:64939837-64939859 AAACTACATCACATGGAAAATGG - Intergenic
1026951219 7:74348275-74348297 AAAATTCCCCAGATTGATAAGGG + Intronic
1028074480 7:86494652-86494674 AAACTTCCACTCATGGAGAAAGG - Intergenic
1029715860 7:102325248-102325270 AAACTTCCTGCGATGGCGAGGGG + Intergenic
1029885329 7:103863732-103863754 AAACTTCCTCATCTGTAGAATGG - Intronic
1030073233 7:105715271-105715293 CACCTTCCTCATGTGGAGAATGG + Intronic
1030765354 7:113402409-113402431 AAGCTTCTTAAGATGGAGGAGGG - Intergenic
1031072329 7:117175584-117175606 AAGCTCCCTCAGTTGGTGAAAGG - Intronic
1031346184 7:120670418-120670440 AACCTCCCAAAGATGGAGAAGGG + Intronic
1032375526 7:131412400-131412422 AAAGTTCCACAGATTTAGAATGG - Intronic
1034136767 7:148778174-148778196 ACAGTTCTTCAGATGGAGCATGG - Intronic
1034407481 7:150914811-150914833 TAAATTTCTCAGAAGGAGAAGGG - Intergenic
1034507888 7:151509522-151509544 AGATTTCCTTAGAGGGAGAATGG - Intronic
1036043489 8:5113299-5113321 AAACTTCCACTGGTGGAGAATGG + Intergenic
1037977325 8:23222934-23222956 AAACTTCCACTGGTGGTGAAGGG - Intronic
1039210724 8:35210832-35210854 AAACATCCTAAAATGAAGAATGG + Intergenic
1039674746 8:39649814-39649836 GAATTTCCTCACAAGGAGAAAGG - Intronic
1039932353 8:42005106-42005128 AATGTTCCTCAAATGGGGAATGG - Intronic
1040421761 8:47246914-47246936 AAACTTCCCCAGCTGGATATAGG - Intergenic
1040618659 8:49064783-49064805 CAGCTTCCTCATATTGAGAATGG + Intronic
1041078763 8:54193956-54193978 AAACTTCCTCAAAATGATAAAGG - Intergenic
1041559139 8:59194966-59194988 AAAGGTACTTAGATGGAGAAAGG + Intergenic
1041566009 8:59280008-59280030 CCACTTCCTCAGATGTAAAAAGG - Intergenic
1041576196 8:59398415-59398437 AAACTTGCGTACATGGAGAAGGG + Intergenic
1041686378 8:60648752-60648774 AACCTTCAGAAGATGGAGAAGGG - Intergenic
1042557722 8:70047531-70047553 CAACTTCCCCAGATTCAGAAAGG + Intergenic
1043422827 8:80116996-80117018 GAACTTCCTCAGTTTGATAAAGG + Intronic
1045039353 8:98206883-98206905 AGACATCTTAAGATGGAGAAAGG - Intronic
1045720430 8:105103400-105103422 CATCTTCCAAAGATGGAGAATGG - Intronic
1045995959 8:108361927-108361949 GAAGTTCCTCAGAAGGTGAATGG - Intronic
1046093644 8:109532981-109533003 AAGTTTCCTCATTTGGAGAAGGG - Intergenic
1046926146 8:119791160-119791182 GCATTTCCTCAGATGTAGAATGG - Intronic
1050112125 9:2228035-2228057 AAATTTCCTCATATGTAAAACGG - Intergenic
1050531155 9:6590571-6590593 AAACTTCCTCTCATGAAGGAAGG - Intronic
1051169538 9:14306125-14306147 AAAATACCTGAGAAGGAGAATGG - Intronic
1051607783 9:18933182-18933204 AAACTTCCTCAGCCTGATAAAGG - Intronic
1052596951 9:30573821-30573843 AAATTTCCTTAGATGGTCAAAGG - Intergenic
1053369220 9:37546421-37546443 AGACTTCATCAGATGTAGTAGGG + Intronic
1053436257 9:38076517-38076539 AAGCTTCCACAGAAGGAAAAGGG - Intergenic
1054726038 9:68651118-68651140 GACCTTCCTTAGATGGGGAAAGG - Intergenic
1055727915 9:79251237-79251259 AGATTTCCTGAGAAGGAGAAAGG - Intergenic
1056139101 9:83657189-83657211 AAACTTACTAAGAAGGAGAGTGG - Intergenic
1056409824 9:86313946-86313968 AAACTTAATCTGATGGGGAAAGG + Intronic
1057394687 9:94669335-94669357 AAACTTGCACAGATGGGGAGGGG + Intergenic
1057808449 9:98238696-98238718 AAACTTCCCCAGCTTGATAAAGG - Intronic
1058359943 9:104133251-104133273 AAACTTCCTCCAAAAGAGAATGG - Intronic
1059371770 9:113845676-113845698 CAAATTCCTCAGAAAGAGAATGG + Intergenic
1059652172 9:116325084-116325106 CCACTTCCTCTGGTGGAGAAAGG - Intronic
1060306886 9:122421727-122421749 AAGATTTCTCAGATGGAGAATGG - Intergenic
1060426430 9:123510531-123510553 AAACTTCCTCACCTGTAGAATGG - Intronic
1061409712 9:130413398-130413420 GAACTTCCTCAGCCTGAGAAAGG - Intronic
1062219743 9:135408833-135408855 CAGTTTCCTCAGATGGAGAATGG - Intergenic
1186515817 X:10165447-10165469 CAACTGCCTCAGATGGAAAGAGG - Intronic
1187268491 X:17759152-17759174 AGACTTCCCAACATGGAGAACGG - Intergenic
1189180513 X:39000205-39000227 TTACTTCCTCAGATGGTGACAGG - Intergenic
1190043748 X:47094972-47094994 GAACTTCCTCAATTTGAGAAAGG - Intergenic
1190452475 X:50595484-50595506 AAATCTCCTGAAATGGAGAAAGG - Exonic
1192404652 X:70872101-70872123 ATACTTCCTCATATGCAGAATGG + Intronic
1192525980 X:71844759-71844781 AAACTTCCTCAACTTGATAAAGG - Intergenic
1194310742 X:92302617-92302639 AGACTTCCACAGATTGTGAAGGG + Intronic
1194743605 X:97604712-97604734 AAACTACCTCTGATACAGAAGGG + Exonic
1194880358 X:99243112-99243134 AAACCTACTCAGATGGAGCTGGG - Intergenic
1195218768 X:102726165-102726187 CAGCTTCCTCATATGTAGAATGG - Intronic
1195897993 X:109768060-109768082 AAACTTCCTCAGCTTGATAAAGG + Intergenic
1195917939 X:109954098-109954120 AAACTTCCTGAAAGGAAGAATGG + Intergenic
1196093789 X:111776569-111776591 AGATATTCTCAGATGGAGAAAGG - Exonic
1197310011 X:124893362-124893384 ATACTTCCTCATATGTAAAATGG + Intronic
1197930052 X:131685322-131685344 AGACTTCCTCAAATTGATAAAGG - Intergenic
1198177390 X:134170586-134170608 AAATTTTCTTAGATGGAGAGGGG - Intergenic
1199126419 X:144127124-144127146 AAAATTCATCTGATGGAGCATGG - Intergenic
1199208138 X:145173671-145173693 AAAAGTCCTCAGATGGAGCAAGG + Intergenic
1200304884 X:155014273-155014295 AAACTTCCTCAATTTGACAAAGG + Intronic
1200615707 Y:5377453-5377475 AAACTTGTTCATATGGTGAAAGG + Intronic
1200619020 Y:5416901-5416923 AGACTTCCACAGATTGTGAAGGG + Intronic