ID: 995405698

View in Genome Browser
Species Human (GRCh38)
Location 5:111793100-111793122
Sequence CTGTAAATTCAAATGAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 378}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995405696_995405698 -7 Left 995405696 5:111793084-111793106 CCCAGTAAACTAGGTGCTGTAAA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG 0: 1
1: 0
2: 4
3: 32
4: 378
995405697_995405698 -8 Left 995405697 5:111793085-111793107 CCAGTAAACTAGGTGCTGTAAAT 0: 1
1: 0
2: 1
3: 6
4: 103
Right 995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG 0: 1
1: 0
2: 4
3: 32
4: 378
995405694_995405698 3 Left 995405694 5:111793074-111793096 CCACAAGTCACCCAGTAAACTAG 0: 1
1: 0
2: 1
3: 14
4: 171
Right 995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG 0: 1
1: 0
2: 4
3: 32
4: 378
995405693_995405698 29 Left 995405693 5:111793048-111793070 CCAGGCATGACAAATGACAGAAC 0: 1
1: 0
2: 0
3: 10
4: 171
Right 995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG 0: 1
1: 0
2: 4
3: 32
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995405698 Original CRISPR CTGTAAATTCAAATGAAACA TGG Intronic
900748484 1:4377678-4377700 CTGTAAATTCAAAACAGACCAGG - Intergenic
901673212 1:10867770-10867792 TTTTAAGTTCAAATGAAATACGG + Intergenic
902122259 1:14176380-14176402 CTGTAACTTAAAATGCCACAGGG + Intergenic
904949142 1:34222088-34222110 CTATAAATTCAAATTAAAAAAGG + Intergenic
905705860 1:40057041-40057063 CTATAAATACAAATGAAATATGG + Intronic
906772112 1:48494534-48494556 CTGTAACTGCAAAGAAAACAGGG - Intergenic
906791611 1:48663242-48663264 CTGTAAGATAAAATGAAAGATGG + Intronic
907049608 1:51321283-51321305 CTGTAAATACAAATCAATAATGG - Intronic
907369270 1:53989606-53989628 CTGTAAGAAGAAATGAAACATGG + Intergenic
908321054 1:62979341-62979363 CTTTAAATTCAAATGTAGTATGG + Intergenic
908556723 1:65263957-65263979 CTGTGAAGAAAAATGAAACATGG - Intronic
908822643 1:68103892-68103914 CCTTAAATTGAACTGAAACATGG + Intronic
909013596 1:70360243-70360265 CAATAAATTCAATTGAAACAGGG + Intronic
909330863 1:74408749-74408771 CTTCAAATCCAAATGCAACATGG + Intronic
909376861 1:74950949-74950971 CTGTAAAATCAAAAGAAAGTTGG - Intergenic
909871607 1:80746396-80746418 CTGGCATTTGAAATGAAACAAGG + Intergenic
910000434 1:82334850-82334872 TTGAAGATTCAATTGAAACAAGG + Intergenic
910726022 1:90339871-90339893 CTGTCAATTCACATTAAAAATGG - Intergenic
911271746 1:95810083-95810105 CTGTAAATTAAACTGACAAAAGG + Intergenic
911420861 1:97638788-97638810 CTGTAAGTTCACATGAGACCTGG - Intronic
913124107 1:115769387-115769409 CATTAAACTAAAATGAAACAAGG + Intergenic
913365871 1:118037941-118037963 TGGGAAATTCAAATGAACCATGG + Intronic
914236284 1:145814844-145814866 CTGTACATTCAAATTTCACATGG + Intronic
915444768 1:155968327-155968349 CTGTAAATCCCTATGAAACTTGG - Intronic
916737716 1:167622802-167622824 CTGTAAATTAGAATGACCCAGGG - Intergenic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917016861 1:170541651-170541673 ATGTCAACTCAAATTAAACAAGG - Intronic
918762372 1:188428323-188428345 CTGTTATTTAAAATGAATCAGGG - Intergenic
919456506 1:197826787-197826809 CTATATATTAAAATGAAATAGGG + Intergenic
919527341 1:198669802-198669824 CTGTAAAGTCAACTGAATGATGG + Intronic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
921441701 1:215194674-215194696 ATATAAATGTAAATGAAACATGG + Intronic
921999284 1:221458489-221458511 CTGTAATTTGATATTAAACAAGG - Intergenic
1063106944 10:3000325-3000347 CATGAAATTCAAATAAAACAGGG + Intergenic
1063617766 10:7616524-7616546 CTTTTAATTAAAATGGAACATGG + Intronic
1063618901 10:7626750-7626772 CTCTGAATTCAAATGAAACTGGG + Intronic
1064004624 10:11690144-11690166 GTGTAAATTCCACTGAAACCTGG - Intergenic
1065965966 10:30770359-30770381 CTGTTTATTCAAAAGAGACAGGG + Intergenic
1066350726 10:34634675-34634697 AAGTACCTTCAAATGAAACATGG + Intronic
1068439522 10:57032888-57032910 CTGTAAAATCAAAAGCAAGATGG - Intergenic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1070376397 10:75835469-75835491 CTGTGAATTCATATGGAAAAAGG - Intronic
1070512786 10:77176550-77176572 CTGTAAAATAACATGAAGCATGG + Intronic
1070947656 10:80407049-80407071 CTGTAAGTTTACATGGAACATGG + Intergenic
1071792695 10:88972229-88972251 ATTTAAAATGAAATGAAACAAGG + Intronic
1072509036 10:96100006-96100028 CTGTGAAGACAAATAAAACAGGG + Intergenic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1073999260 10:109352301-109352323 CTGTGAATTCATCTGAAACACGG + Intergenic
1074051715 10:109886732-109886754 CTGTAAATACTGATGCAACAGGG + Intronic
1074131083 10:110576653-110576675 CTACAAATTCAAACTAAACAAGG - Intronic
1074326120 10:112453071-112453093 CTGTAAAGTCATCAGAAACAAGG - Intronic
1075775452 10:124982603-124982625 CTCTAAGTTCAAATGAACCATGG - Intronic
1075954395 10:126509426-126509448 TTGTAAATTCCACTGAAATATGG - Intronic
1076146140 10:128124458-128124480 ATGGAAATTCAAATGAATCCTGG + Intronic
1079484908 11:20925590-20925612 CTGGAGTTTTAAATGAAACATGG + Intronic
1079711082 11:23682528-23682550 CTGTATATTGAGATGATACATGG + Intergenic
1079968562 11:27007868-27007890 CTTTAAATTCCTATGAAATAAGG - Intergenic
1080172014 11:29315857-29315879 CTGTAGTTTCCAAGGAAACAGGG - Intergenic
1080817133 11:35769452-35769474 TTGTAAATTAAAAAGAAACAAGG - Intronic
1080914261 11:36639386-36639408 CTGAAAATGAAAATCAAACAAGG - Intronic
1082163265 11:48908144-48908166 TTGTAACTTCTAATAAAACATGG - Intergenic
1082271090 11:50170174-50170196 TACTACATTCAAATGAAACATGG + Intergenic
1084177079 11:67428553-67428575 CTCCAAATCCAAATCAAACACGG - Exonic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084551093 11:69842671-69842693 CTGGGACTTCCAATGAAACAAGG + Intergenic
1086000666 11:81981229-81981251 CAGCAAAGTCAAATGATACATGG - Intergenic
1086596103 11:88573006-88573028 CTAGAAATGCAGATGAAACATGG + Intronic
1086859172 11:91904697-91904719 ATGGAAATACATATGAAACAAGG - Intergenic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1087733534 11:101805808-101805830 CCATAAATTTATATGAAACACGG + Intronic
1088081623 11:105923329-105923351 CTCTAAAATCAAGTGAAATAAGG - Intronic
1088160122 11:106859020-106859042 CTGTAAATTAAAATTAACCCTGG + Intronic
1091719224 12:2800522-2800544 CTGTAGTTTCAGATGACACATGG - Exonic
1093982790 12:25493485-25493507 TTGTGAATTTAATTGAAACAAGG - Intronic
1095357739 12:41296237-41296259 CTGTAACAGGAAATGAAACATGG + Intronic
1097395650 12:59070975-59070997 CACTAAATTTAAATGTAACACGG + Intergenic
1097606482 12:61760979-61761001 CATTAAATTCTCATGAAACAGGG + Intronic
1098305819 12:69101633-69101655 CTGTAACGTGAGATGAAACATGG + Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1098661921 12:73105502-73105524 CTGTAAGTACGAATGATACATGG + Intergenic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1099706473 12:86159638-86159660 CTGTAAATTCACCTGAACCAGGG + Intronic
1100370398 12:93964357-93964379 CTGCAACTTCATATGAAACCTGG - Intergenic
1100388476 12:94125841-94125863 CTGTAAATTAAAAGGAAAAAAGG - Intergenic
1100649313 12:96567418-96567440 CTGGAAATTCAAATTTAACCAGG - Intronic
1100718925 12:97335773-97335795 CTGTGAATTAAAATAAAGCACGG - Intergenic
1101389164 12:104284624-104284646 CTGTAAAGACAAAATAAACAAGG + Intronic
1102550316 12:113686898-113686920 CTTTAAATTAAAATGAAAATTGG + Intergenic
1103225783 12:119286429-119286451 CTTTAACTTTAAATGAAACTTGG + Intergenic
1104533176 12:129592091-129592113 GTTTAAATTCTAATAAAACATGG - Intronic
1106955179 13:34929689-34929711 CTGTACCTTGAAATGACACATGG + Intergenic
1107385977 13:39909802-39909824 CTGAAAATTCACATAACACATGG - Intergenic
1107824286 13:44313482-44313504 CTGTAAAATCAAATAAAACATGG + Intergenic
1109533769 13:63688465-63688487 CTGTAAAGGCAAATGAAAAATGG - Intergenic
1109607697 13:64719068-64719090 CTAGAAATTCAAATGAATGAAGG - Intergenic
1109787487 13:67198418-67198440 CTGTGAATTCAAAAGAAAACTGG - Intronic
1109854822 13:68112906-68112928 CTGTAATATAAATTGAAACAAGG - Intergenic
1110689455 13:78415295-78415317 CTGTGTTTTCAAAAGAAACATGG + Intergenic
1110869524 13:80434177-80434199 CTGTAAATTAAATTGACATAAGG + Intergenic
1112369634 13:98783688-98783710 CTGTGAAGTCAAGAGAAACAGGG + Intergenic
1112757193 13:102649778-102649800 ATGTAAATACAAATCAAACTTGG + Intronic
1114141621 14:19917950-19917972 ATGAAAAGTTAAATGAAACAGGG + Intergenic
1114334601 14:21675278-21675300 CTGTTAAAACAAATGAAATATGG + Intergenic
1114335503 14:21685415-21685437 CTGAAAGGTCAAATGAGACAAGG - Intergenic
1115462380 14:33675692-33675714 ATGTAAATTTAAATGTAAGAAGG - Intronic
1116548984 14:46210043-46210065 CTTTACACTCCAATGAAACATGG - Intergenic
1117034763 14:51716593-51716615 CTGTCAATCCAAATGAGACCCGG + Intronic
1118247293 14:64123616-64123638 CTGACAAATAAAATGAAACAGGG - Intronic
1120102321 14:80459593-80459615 CTGTTAAGTTCAATGAAACATGG - Intergenic
1121614283 14:95302458-95302480 ATATAAAGTCAAAAGAAACAGGG + Intronic
1122020345 14:98832996-98833018 CTTTGCATTCAAATAAAACATGG + Intergenic
1122079967 14:99260195-99260217 TTGAGAATTCAAAGGAAACAGGG + Intronic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1125471371 15:40007559-40007581 CTGTACATTCAAATACCACAGGG + Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1128350582 15:66885752-66885774 CTGTAACCTCAAATGAAGGAAGG + Intergenic
1128722992 15:69965884-69965906 CTGTATTTTCAATAGAAACAGGG + Intergenic
1130775940 15:86983024-86983046 TAGTAAATTCTAATGAAAAATGG - Intronic
1131558088 15:93416422-93416444 AAGTAAATTCAAATGGAACTAGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134467544 16:14492656-14492678 CTGTAAAGTGAAGTGACACATGG - Intronic
1135645787 16:24160653-24160675 ATGTAAATTCCAAAGAAACAGGG - Intronic
1137536443 16:49330540-49330562 CTGTCAATTCTAAAGAAGCAGGG - Intergenic
1137566642 16:49537473-49537495 TTGGAAATTCAAACGCAACATGG + Intronic
1137658226 16:50179852-50179874 CTGTTAAATCAAATAAAACCAGG + Intronic
1139304031 16:65968250-65968272 CTGTAACTTCAACTGAAAATGGG - Intergenic
1140014895 16:71172700-71172722 CTGAAAATCCAATTGAAAGAGGG + Intronic
1141222528 16:82084417-82084439 CTGCAGATTTAAATGAACCATGG + Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141410003 16:83826598-83826620 CGGGAAAATCGAATGAAACACGG - Intergenic
1143060995 17:4200958-4200980 CTGTATATTCAAATGAAAATGGG - Intronic
1145928142 17:28663094-28663116 CTGTAATATCAAAAGTAACAAGG + Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147175455 17:38653367-38653389 CTTTAAAGTCAAAAGACACATGG - Intergenic
1147692529 17:42325379-42325401 CTGTATCTTCACATGAAACAGGG + Intronic
1149227801 17:54495824-54495846 CTGTATATTCCATTCAAACAAGG + Intergenic
1149447367 17:56724063-56724085 CTGTAAAGTCACATGGAAAAAGG + Intergenic
1149883818 17:60320158-60320180 CTGCAACTTCAAATGACACCAGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151904858 17:77041066-77041088 CTGAAAATTCACATGATAAAAGG - Intergenic
1153545924 18:6204626-6204648 TTGGAAATGCAAATAAAACAAGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156069681 18:33192052-33192074 ATTTAAATTCAATTTAAACAAGG - Intronic
1156860534 18:41830958-41830980 CTGTAAATTCCAACCAAACCTGG - Intergenic
1157347754 18:46855055-46855077 CTATAAATTCAAATCAAGCCTGG + Intronic
1157550309 18:48576648-48576670 CCGTAATACCAAATGAAACAAGG + Intronic
1158251593 18:55494482-55494504 CTTTAAATGCAAATGCATCAGGG - Intronic
1158907908 18:62031659-62031681 ATGAATATTCAAAAGAAACAGGG + Intergenic
1159408566 18:68038702-68038724 CAGGAAATTAAAATAAAACATGG + Intergenic
1159476083 18:68922501-68922523 TTATCAGTTCAAATGAAACAAGG + Intronic
1160023867 18:75203794-75203816 ATGTAAATTTAAAGGAAAGATGG - Intronic
1160109850 18:76015928-76015950 CTGTAAAAGCAAATGAAAGCAGG + Intergenic
1163974091 19:20832047-20832069 CTATTAATTCAAATGAAAACTGG - Intronic
924987274 2:283586-283608 CTGTAAATTCTAAAGAAAGTGGG + Intronic
925504323 2:4543903-4543925 CTGTAACCTCATATGAAAGAAGG + Intergenic
926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG + Intergenic
926771015 2:16375285-16375307 CAGTCAATTCAGTTGAAACAAGG - Intergenic
926953921 2:18272485-18272507 CTGTAACAAGAAATGAAACATGG + Intronic
928311147 2:30210848-30210870 CTGGAAATTAAATTTAAACATGG + Intergenic
930260688 2:49142679-49142701 CTGTTAATTCAAGTGAAACAAGG + Intronic
930916760 2:56700676-56700698 CTTTACATTCAAATTAAAAAAGG - Intergenic
931095434 2:58934967-58934989 CTGAATAATCAAATGAATCAAGG + Intergenic
931862043 2:66365437-66365459 CTGCAAATTCAACTGAGAAAAGG + Intergenic
931879287 2:66550411-66550433 TTAAAAATTCAAATCAAACATGG - Intronic
931996036 2:67840094-67840116 CTTTAAATTCAAATGGACCTGGG - Intergenic
933030163 2:77318510-77318532 CTGAAAATTAAAATGACACCTGG + Intronic
933885454 2:86715838-86715860 CTGTTAATAAAAATGAATCAGGG - Intronic
934123622 2:88864947-88864969 CTGTAACATAAAATGAAACATGG + Intergenic
934849230 2:97686716-97686738 CTTTTAAATCAACTGAAACAGGG - Intergenic
938204449 2:129406412-129406434 ATTTATATTCAAAAGAAACACGG + Intergenic
938222227 2:129580282-129580304 CTGGTAATTCATATGAAACCTGG - Intergenic
938928051 2:136062242-136062264 CTGTAAATCAAAACAAAACAAGG + Intergenic
939287291 2:140148763-140148785 ATGTAGATCCAAATGAAACATGG + Intergenic
939557881 2:143698762-143698784 GAGTAAATGCAAATGAAAGAGGG + Intronic
940910446 2:159205307-159205329 AGGTAAATTCAAATGAAGAACGG - Intronic
941199947 2:162495983-162496005 CTGTAAATCAAAATGAATCAAGG - Intronic
941274470 2:163473255-163473277 GTGTACATTCGAAAGAAACAGGG + Intergenic
941884842 2:170517266-170517288 GTGTAAATTAATAAGAAACATGG + Intronic
942467787 2:176226822-176226844 ATTTAATTTCAAATGAAATATGG - Intergenic
942852443 2:180505043-180505065 TTCTAAATTACAATGAAACATGG + Intergenic
943293173 2:186101877-186101899 CTGTAAAATCAAATGAACTTTGG - Intergenic
943492305 2:188570216-188570238 CAGTAATTTCAAAGTAAACATGG + Intronic
944631286 2:201627456-201627478 CTATAAATTCAAAATAAACCAGG - Intronic
945042582 2:205754700-205754722 CTTTACATTCAGATAAAACATGG - Intronic
946646751 2:221845703-221845725 CCATAAATTCAGATAAAACATGG + Intergenic
947292063 2:228586530-228586552 TTCTGAATTCAAATAAAACAAGG - Intergenic
1169484376 20:6014548-6014570 CTGTCTATTCACATTAAACAAGG - Intronic
1171723207 20:28587325-28587347 ATTTAAATTTAAATGAAAGAGGG - Intergenic
1171754841 20:29095782-29095804 ATTTAAATTTAAATGAAAGAGGG + Intergenic
1171787812 20:29486760-29486782 ATTTAAATTTAAATGAAAGACGG - Intergenic
1171860137 20:30392631-30392653 ATTTAAATTTAAATGAAAGAGGG + Intronic
1172003380 20:31799597-31799619 CTGTCAATTAAAAAGAAAGAAGG + Intronic
1174511138 20:51053715-51053737 TTGTAAAGTGAAATTAAACATGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176692491 21:9932889-9932911 CTGTTAAATCAAATTAAATATGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179579998 21:42337048-42337070 ATGTAAATTAAAATGAAAACAGG + Intergenic
1179963103 21:44782261-44782283 CTAAAAATTCAAATGTATCATGG + Intronic
1180296768 22:10945975-10945997 ATTTAAATTTAAATGAAAGAGGG - Intergenic
1180411838 22:12619585-12619607 ATTTAAATTTAAATGAAAGAGGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1181920850 22:26319399-26319421 CTTTAAGTCCAAATAAAACAGGG - Intronic
1181948042 22:26533606-26533628 TTTTAAAATAAAATGAAACAAGG + Intronic
1184830023 22:46979331-46979353 CTGTCACTTCAAAAGAAACAAGG - Intronic
951462627 3:22967861-22967883 ATGTAAATTCCAATGAAGGAAGG + Intergenic
952191396 3:31026773-31026795 CTGTAAACTCAAATTAGAGAGGG + Intergenic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954977288 3:54708320-54708342 CTGCATGTTCTAATGAAACATGG + Intronic
955569274 3:60286858-60286880 ATATAAATTCAAATGTAAGATGG + Intronic
955795034 3:62627107-62627129 CTGGAAAGTAAAATGTAACATGG - Intronic
955818303 3:62871036-62871058 CTGTGAATTGAAATATAACATGG - Intronic
956002134 3:64740875-64740897 CTTTAAAAAAAAATGAAACAAGG + Intergenic
956319102 3:67975680-67975702 CAGAAAATTCACATGAAAAAAGG + Intergenic
956942176 3:74175917-74175939 CTGTAAGTTCAAGTGAAAAGAGG - Intergenic
957618878 3:82569353-82569375 CTGTAAATAGAAATCAAACTGGG - Intergenic
959314643 3:104787408-104787430 CCCCAAATTCAAATGAAATAAGG + Intergenic
959460222 3:106616353-106616375 CTGTAAATTAAAATATGACAGGG - Intergenic
959779755 3:110215730-110215752 GTGCAAATTGAAATGAAATATGG - Intergenic
959836137 3:110920486-110920508 CTGCAACATCAAAGGAAACAGGG - Intergenic
960551839 3:118984612-118984634 ATGTAAATTCAAATGAAAGAGGG + Intronic
964777761 3:160297000-160297022 CTGTATAATTAAATGATACAGGG - Intronic
964840787 3:160991311-160991333 CAGTAACTGAAAATGAAACAGGG - Intronic
965362416 3:167757594-167757616 CTGTATATTCAAATGAACCAGGG + Intronic
966390210 3:179444540-179444562 CTGTGTATTTAAATGGAACATGG - Intronic
967546553 3:190736896-190736918 CTGCAAATTCAGATGGATCATGG - Intergenic
967626030 3:191684855-191684877 CTTTGAATTCACAGGAAACACGG - Intergenic
967637726 3:191823696-191823718 CTGTAAATTCATATGATACTGGG - Intergenic
968560851 4:1280988-1281010 CTATAAACACAAAAGAAACAGGG + Intergenic
970292857 4:14595105-14595127 CTTTATATTAAAATGAAACAAGG - Intergenic
971651093 4:29275294-29275316 GTGAAAATTAAAATGACACAAGG + Intergenic
971789244 4:31146768-31146790 CTGCAAATTAAAATATAACATGG + Intronic
972242633 4:37209833-37209855 CTGTAAAATTAAATGAGAGAAGG - Intergenic
972854429 4:43089924-43089946 CAGAAAATTCAGAGGAAACATGG - Intergenic
972912855 4:43839834-43839856 ATGAAAATGAAAATGAAACATGG - Intergenic
972996583 4:44886364-44886386 CTGTTTATTCAAATGTATCAAGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974212359 4:58795583-58795605 CTGTAAATTGAGAAGAAAGAAGG + Intergenic
975018939 4:69463240-69463262 CTGAAAATGCAAAGGAAACACGG + Intergenic
975078688 4:70247304-70247326 CTATAAAAACAAATGAAAGATGG + Intronic
975248632 4:72150144-72150166 TTGTATATTCAAATAACACATGG - Intergenic
975339956 4:73227970-73227992 CTATATATTCAAACAAAACAAGG + Intronic
976568961 4:86586453-86586475 CTGCAAATTCAAATTAACGAAGG - Intronic
976948049 4:90794658-90794680 TTTAAAATTCAAATGGAACAAGG - Intronic
978130567 4:105191198-105191220 CTGAAAATACAAAAGAAAGAGGG + Intronic
978653449 4:111037383-111037405 CTGTAACTTCAAATCCAAGAGGG - Intergenic
978806240 4:112803703-112803725 ATCTAAATTCAAATTCAACAAGG + Intergenic
979218466 4:118193783-118193805 CTGTAGTTTCAGATGACACATGG + Intronic
979506866 4:121509087-121509109 CAGAAAATTCAAATTAAAAATGG - Intergenic
979682753 4:123479796-123479818 CTCTAAATACAAATAAATCAAGG - Intergenic
980365079 4:131793110-131793132 CTGTTAAATCAAATTAAATATGG - Intergenic
980615567 4:135219007-135219029 CTGTATATTAAAATGGAGCATGG - Intergenic
980808195 4:137840781-137840803 CTGCAAATTCAGCTGAAATAAGG + Intergenic
981165090 4:141548354-141548376 CTGTAAAATAAAATAGAACAAGG + Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981261330 4:142723129-142723151 TTGTAAATTGAAAAGAAACTGGG - Intronic
981665414 4:147219632-147219654 CTGAACTTTCAAATGAAAAATGG + Intergenic
981874515 4:149524989-149525011 CTTTAAAGTCAATTGAAACAGGG + Intergenic
982131793 4:152235336-152235358 CTCAAAATTCAGATGAAATAAGG + Intergenic
982570557 4:157045625-157045647 CTCAGAATTAAAATGAAACAAGG - Intergenic
983098279 4:163592613-163592635 CTGTGAATTCAAATAAGACTTGG - Intronic
983115631 4:163812583-163812605 TTGTAAATTCAGAAGAGACAGGG - Intronic
983889587 4:173016649-173016671 CTGTAAAATCAAATGCAAGTTGG - Intronic
983921610 4:173351708-173351730 CTTTAAATTCAAATTTAACTGGG + Intergenic
985012194 4:185594441-185594463 ATGTTAATTCAAATGTAGCATGG - Intronic
985353684 4:189094930-189094952 CTGCAAAATAAAATAAAACATGG + Intergenic
985438304 4:189956460-189956482 ATTTAAATTTAAATGAAAGAGGG + Intronic
986607521 5:9536744-9536766 CTGTAAATAGAAAAGAAAAATGG - Intronic
986895081 5:12355895-12355917 TTGTCTATTCAAATAAAACAAGG + Intergenic
987291704 5:16514442-16514464 CTGAAGATACAAGTGAAACAAGG - Intronic
987852081 5:23368794-23368816 CCGTAACTTCAAATACAACATGG - Intergenic
988286373 5:29223049-29223071 CTGTAATTTCAAATGTTCCAAGG - Intergenic
988308081 5:29519859-29519881 CTGAAAACTCAAAAGAAATAGGG - Intergenic
988368089 5:30328602-30328624 CTGTAACTTCACATGACAGAAGG + Intergenic
988438082 5:31199919-31199941 CTGGAAATTCAAACCAAAAAAGG - Intronic
988544982 5:32147272-32147294 CTGTAAATTAAAATGCTTCAAGG - Intronic
989375698 5:40757525-40757547 CTGTAACTTCAAGAAAAACAAGG + Intergenic
989763778 5:45053628-45053650 CTGTAAATTTAGATGAATAAAGG - Intergenic
989949017 5:50275111-50275133 CTGAAAAGCCAAATAAAACAAGG + Intergenic
990075049 5:51834231-51834253 TTGTAAATTCATTGGAAACAGGG - Intergenic
990645679 5:57841574-57841596 CTGTGTATTCAAATGTAATAAGG - Intergenic
991317235 5:65322445-65322467 CTGTAAATTTACATGCAGCATGG + Intronic
991342727 5:65629020-65629042 CTGTAAATTCTAATCCAACATGG - Intronic
991999576 5:72422555-72422577 CTGTAACAGAAAATGAAACATGG - Intergenic
992812831 5:80407262-80407284 CTATAAATTTAAATGAGACCCGG - Intergenic
993734360 5:91458482-91458504 CTGTCACTTCACATGACACATGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995384166 5:111570322-111570344 TTGCAAATTCAAATGTTACAGGG - Intergenic
995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG + Intronic
995971379 5:117975014-117975036 CTGAAAATTATAATTAAACAAGG + Intergenic
996257702 5:121426087-121426109 CTGTAAAATCAAAAGCAACTTGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
998518063 5:142773341-142773363 CTGTAAAATAAAATAAAATATGG - Intronic
1000614534 5:163412763-163412785 ATGTAAATTCATATGAAACTAGG - Intergenic
1000966203 5:167659957-167659979 CTGTAAATACACCTGAAATAAGG + Intronic
1001111687 5:168901856-168901878 CTGTCTATTCAAATGTCACAGGG - Intronic
1003585869 6:7389017-7389039 CTGTAAGGACAAATGAAAGATGG - Intronic
1004452748 6:15762180-15762202 CTGAAAATTCAAATGTAACTGGG - Intergenic
1005203811 6:23377922-23377944 CTGAAAATTCTAAAGACACATGG - Intergenic
1005498342 6:26408215-26408237 ATGTAAAGTCAAATGACAAAAGG + Intronic
1005846956 6:29789264-29789286 CTGAGGATTCACATGAAACATGG - Intergenic
1005858650 6:29884481-29884503 CTGAGGATTCACATGAAACATGG - Intergenic
1005863792 6:29923007-29923029 CTGAGGATTCACATGAAACATGG - Intergenic
1005866204 6:29939308-29939330 CTGGGAATTCACAAGAAACATGG - Intergenic
1007960999 6:45959145-45959167 TTGTAAATTCAAGTGGAAAATGG + Intronic
1008620478 6:53266527-53266549 CTGTAAATTCAAAATAAGTAGGG + Intergenic
1010424051 6:75706406-75706428 ATGTGAATTCAAATGAATTAAGG + Intronic
1010628307 6:78166581-78166603 CTGTAATCTCACATGAAAGAAGG + Intergenic
1011015470 6:82749458-82749480 CAGTAATTTGAAATGAAATAAGG - Intergenic
1011786521 6:90852164-90852186 TTTTACATTCAAATAAAACATGG - Intergenic
1011886745 6:92106059-92106081 CTGTGAATTCATATGGACCAGGG + Intergenic
1012350710 6:98246689-98246711 CTCTAGATTCAGATGAAACTTGG + Intergenic
1012945881 6:105465065-105465087 CTGAAAGTTCAAATAAAATAGGG + Intergenic
1013081979 6:106821201-106821223 CTCTAAAAACAAATGAGACATGG - Intergenic
1013574796 6:111471468-111471490 GTTTGAATTGAAATGAAACATGG - Intronic
1013577793 6:111502012-111502034 TTGTAAATTCAAATTTAACTAGG + Intergenic
1013734089 6:113205641-113205663 CAGTAAAATCAAAGGAAAGAGGG - Intergenic
1013993186 6:116278375-116278397 CTGAATATCCAAAGGAAACAGGG + Exonic
1015314915 6:131807525-131807547 ATGGAAATGCAAATGAACCATGG - Intergenic
1016272328 6:142302634-142302656 TTTTCAATTCAAATTAAACAAGG + Intronic
1017545650 6:155448713-155448735 CTGAAAAATAAAATGAAAGAAGG - Intronic
1017614882 6:156235651-156235673 CAGTAAATTCAAAGGTAAGAAGG + Intergenic
1017700111 6:157061225-157061247 ATGTAAATTCAAATGCAGCCAGG - Intronic
1018089544 6:160333807-160333829 GTTTAAATTCTAATGAAAAAAGG + Intergenic
1020473538 7:8567240-8567262 ATTTAAAATAAAATGAAACAGGG - Intronic
1020668099 7:11072905-11072927 CTGTTAGTTCACATGAAAGATGG - Intronic
1020836002 7:13151887-13151909 CTTTGAAATCAAATGAAACTTGG - Intergenic
1022326056 7:29333007-29333029 ATGTTCATTCAAAGGAAACATGG + Intronic
1023935139 7:44734314-44734336 CTGTAAAAACAAAACAAACAAGG - Intergenic
1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG + Intergenic
1027744767 7:82059263-82059285 CTATGAATTAAAATGACACATGG + Intronic
1027745875 7:82073252-82073274 TTCTAAATAAAAATGAAACAAGG - Intronic
1027751459 7:82152494-82152516 CTTGAAATTCAAATGTAACTGGG + Intronic
1028299809 7:89183806-89183828 CTGTATATTCAAATGCCAGAAGG - Intronic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030441024 7:109589800-109589822 TTTTAAATTCTAATGAAAGAAGG + Intergenic
1030908611 7:115217639-115217661 CTGTATATTCACATGTATCAGGG + Intergenic
1031211009 7:118826104-118826126 CTGTACATTAAAATGATCCAAGG - Intergenic
1032685203 7:134225539-134225561 GTGGAAATACAAATGTAACAAGG + Intronic
1033165283 7:139034865-139034887 CTGAAAATTCAAATGACCCTGGG - Intronic
1033474747 7:141681140-141681162 CTACAAATTCAGATGACACAGGG - Intronic
1033808990 7:144987958-144987980 CTGTAAGTTCACATGCATCATGG - Intergenic
1035918006 8:3645802-3645824 CTGTCTATTCAAATGACACTGGG + Intronic
1036013652 8:4756708-4756730 CTGTAACTCCAAAAGAAATATGG - Intronic
1036374023 8:8184705-8184727 GTGTAAGTACAAATGAAAAATGG - Intergenic
1037063935 8:14552592-14552614 ATGTAAATTATAATGCAACATGG - Intronic
1037266535 8:17068187-17068209 CAGTAACTTCATATGAAATAAGG + Intronic
1037302335 8:17465504-17465526 CTTAAAAATCAAATGCAACAGGG + Intergenic
1037421762 8:18709904-18709926 CTGAAAATTAAAAAGAAATAGGG + Intronic
1038648120 8:29378266-29378288 CTGAAAAATCAACTGAAATAAGG + Intergenic
1039769792 8:40673823-40673845 CAGGAACTTCAAATGATACATGG + Intronic
1041281626 8:56215817-56215839 CTATAAATTCAAAGGAAAGTAGG - Intronic
1041620846 8:59967106-59967128 TTGTAAATTAAAATGACAAAAGG - Intergenic
1041714207 8:60919428-60919450 CTTTAGCTTCAAGTGAAACAGGG + Intergenic
1041979020 8:63833907-63833929 CTGTAAATTAAACTGACAAAAGG + Intergenic
1042079376 8:65034466-65034488 TTATATATTCAAATGAAATATGG + Intergenic
1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG + Intergenic
1042522233 8:69725827-69725849 CTGAAAATCCAGAGGAAACAAGG - Intronic
1042617655 8:70668413-70668435 CTGCAAATTAAACTCAAACAAGG + Intronic
1043007379 8:74836531-74836553 CAGTGAATATAAATGAAACAAGG + Intronic
1043659599 8:82721335-82721357 ATGTTAATATAAATGAAACATGG + Intergenic
1045116557 8:98989321-98989343 ATGGAAAATCAAAAGAAACAGGG - Intergenic
1045756886 8:105554228-105554250 CTCAAAATGCAGATGAAACATGG + Intronic
1046407955 8:113799724-113799746 TTCTAAATTAAACTGAAACATGG - Intergenic
1046543257 8:115613906-115613928 CTTTCAATTAAAATTAAACAAGG + Intronic
1046650697 8:116833966-116833988 CTGCACATTGAAATGAAAAATGG - Intronic
1051589214 9:18758974-18758996 CTAAAAATTAAATTGAAACAAGG + Intronic
1051997528 9:23235932-23235954 ATGAAACTGCAAATGAAACAGGG + Intergenic
1052396627 9:27946786-27946808 CAGAAAAGTCAAATGAAAAATGG + Intergenic
1053629437 9:39918961-39918983 CTGTTAAATCAAATTAAATATGG - Intergenic
1053747276 9:41211449-41211471 ATTTAAATTTAAATGAAAGAGGG + Intergenic
1053776331 9:41544589-41544611 CTGTTAAATCAAATTAAATATGG + Intergenic
1053934946 9:43140916-43140938 CTATGAATCCAAATGAAAAATGG - Intergenic
1054214450 9:62331741-62331763 CTGTTAAATCAAATTAAATATGG + Intergenic
1054339055 9:63838756-63838778 ATTTAAATTTAAATGAAAGAGGG - Intergenic
1054365403 9:64333898-64333920 CTGTTAAATCAAATTAAATATGG - Intergenic
1054480010 9:65653911-65653933 ATTTAAATTTAAATGAAAGAGGG - Intergenic
1054875443 9:70091494-70091516 TTTGAAATTCAAATGTAACAGGG - Intronic
1054924503 9:70576036-70576058 CTGGTAATACAAATGAGACATGG - Intronic
1055144603 9:72918027-72918049 CTGTAAATACAAATGGTTCATGG - Intronic
1056153470 9:83812000-83812022 ATGTAATTTTAAATGAAAGAAGG + Intronic
1056357020 9:85810987-85811009 ATGTAATTTTAAATGAAAGAAGG - Intergenic
1056695140 9:88842320-88842342 CTGTAAAGTCAGATGAAAGATGG - Intergenic
1058285553 9:103172571-103172593 GTGTAAATTCAAAAGAGAAAGGG - Intergenic
1058372568 9:104286656-104286678 ATTCAAATTCAACTGAAACATGG - Intergenic
1058934049 9:109751346-109751368 CTGTAAAATCAACAGAAACGGGG - Intronic
1061488401 9:130932224-130932246 TTGTAAATTCAAATTCCACAAGG + Intronic
1062403989 9:136385503-136385525 CTGTAAATTCTGATACAACATGG - Intronic
1202783408 9_KI270718v1_random:22228-22250 ATTTAAATTTAAATGAAAGAGGG + Intergenic
1202803626 9_KI270720v1_random:27142-27164 ATTTAAATTTAAATGAAAGAGGG - Intergenic
1186035444 X:5417754-5417776 CTGAAACTTTAGATGAAACAAGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186639444 X:11439881-11439903 TAGTAAATACAAATGCAACAAGG - Intronic
1186813868 X:13216579-13216601 CTGTGAAATCAAATCAAACATGG - Intergenic
1186833953 X:13418991-13419013 CCGAACATTCTAATGAAACATGG - Intergenic
1187001368 X:15182467-15182489 ATGCAAATTAAAATCAAACAAGG - Intergenic
1187668855 X:21648163-21648185 ATTTTAATTAAAATGAAACATGG - Intronic
1188613276 X:32125713-32125735 TTGTAATTTAAAATTAAACAGGG - Intronic
1189637102 X:43023057-43023079 CTGTAAAATCAAAAGAAAGTTGG + Intergenic
1189671588 X:43416025-43416047 CTGTAACAGGAAATGAAACATGG - Intergenic
1190553016 X:51604353-51604375 CTGTAAATACCAAGGAAATATGG + Intergenic
1191598374 X:62973776-62973798 CTGTAAAATCAAAAGCAACTTGG + Intergenic
1191801981 X:65091860-65091882 TTATTAATTCAAATAAAACAGGG + Intergenic
1193021460 X:76797762-76797784 CTGGGTATTCAAATCAAACATGG - Intergenic
1194770302 X:97895081-97895103 CTGTATATTCAAATAACAGAGGG - Intergenic
1195633311 X:107084114-107084136 TTGTAAATCCAAAGGAAACAAGG - Intronic
1196186090 X:112746596-112746618 CTGGACATTCACATGAAACTTGG + Intergenic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1196638065 X:118026934-118026956 TTGTAACATGAAATGAAACATGG + Intronic
1197556900 X:127967012-127967034 CTGAAAATTATAAGGAAACAAGG + Intergenic
1198021947 X:132667605-132667627 CTGCAAAGCCAAAAGAAACAAGG + Intronic
1198397652 X:136237471-136237493 CTTTAACTTGAAATGAAACCTGG - Intronic
1199195514 X:145025055-145025077 CTGTAAAAGTAAATGAAAGAAGG + Intergenic
1199519960 X:148724098-148724120 CTGTCAATTAACCTGAAACATGG + Intronic
1200107334 X:153722349-153722371 CTGGAAAAGCAAATGAAAGAGGG - Intronic
1201977164 Y:19864312-19864334 CTTTAAAAACAAATGAAAAAAGG - Intergenic