ID: 995408695

View in Genome Browser
Species Human (GRCh38)
Location 5:111830960-111830982
Sequence CTTCCATCACTTATGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995408695_995408699 -7 Left 995408695 5:111830960-111830982 CCCTGTTCCATAAGTGATGGAAG 0: 1
1: 0
2: 1
3: 6
4: 125
Right 995408699 5:111830976-111830998 ATGGAAGGAATTCTCCTATATGG 0: 1
1: 0
2: 1
3: 13
4: 154
995408695_995408700 -6 Left 995408695 5:111830960-111830982 CCCTGTTCCATAAGTGATGGAAG 0: 1
1: 0
2: 1
3: 6
4: 125
Right 995408700 5:111830977-111830999 TGGAAGGAATTCTCCTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995408695 Original CRISPR CTTCCATCACTTATGGAACA GGG (reversed) Intronic
901160132 1:7170897-7170919 GTTCCAGCAAATATGGAACATGG + Intronic
905517654 1:38573774-38573796 CTTAAATCTTTTATGGAACAAGG + Intergenic
907661150 1:56393529-56393551 CTTTCCTCACCTATAGAACAAGG + Intergenic
907758039 1:57330128-57330150 CTTCCTTCACTTAAGCAACCTGG + Intronic
908906659 1:69020456-69020478 CTTCCTTCACTTGTGTGACAAGG + Intergenic
911323718 1:96444808-96444830 CTTCGTTCACTTTTGGAAAATGG + Intergenic
913042867 1:115045480-115045502 CTAACATCACATATTGAACACGG + Intergenic
915979467 1:160410931-160410953 CTGCCATCACCTAGGCAACAGGG + Intronic
917498216 1:175562024-175562046 CTGCCATCACCTGTGGAAGAAGG + Intronic
917750311 1:178047324-178047346 CTACCACCACTCCTGGAACATGG + Intergenic
921754139 1:218833794-218833816 TTTCCTTCACTTGGGGAACATGG - Intergenic
924417175 1:243868908-243868930 CTTCCATCACTCTAGGAAGAGGG - Intergenic
924458672 1:244238822-244238844 CTTTCTTCACTAATGGAAGAAGG - Intergenic
1068042366 10:51841239-51841261 CATTCATCATTTATTGAACATGG + Intronic
1070705704 10:78636457-78636479 GTTCCATAACCTATGAAACATGG - Intergenic
1074653300 10:115550817-115550839 CTTCCTTCCCTAATGGAATAAGG + Intronic
1076161413 10:128246875-128246897 CCTCCATCACTTTTGGTTCAGGG + Intergenic
1076600698 10:131655143-131655165 CTTCCATGACCTAAGGAACGTGG - Intergenic
1078351574 11:10599449-10599471 CTTCCAACACTGACGGAAAATGG + Intronic
1081005917 11:37739213-37739235 CTTCCATTACTTATAAATCATGG - Intergenic
1081947028 11:47005780-47005802 ATTCCAACAATTATGTAACATGG - Intronic
1082618101 11:55386999-55387021 CTTGCATCATTTATAGAACGAGG - Intergenic
1086049394 11:82571226-82571248 CTACCATAACTTTTGTAACATGG + Intergenic
1101370866 12:104129026-104129048 CTTATATCACTTATGGAAGATGG - Intronic
1105586140 13:21744697-21744719 CTTCCTTGACTCATGGAAAATGG + Intergenic
1105849264 13:24319873-24319895 GTTCCCTCACATATGGAACTAGG - Intronic
1106808393 13:33334762-33334784 CTTCCATCAGTTATTGGAAATGG - Intronic
1110527041 13:76550352-76550374 CTTCCATCTATTAATGAACACGG - Intergenic
1112157532 13:96833858-96833880 CTTCCATCTTTTAGGGAACGGGG + Exonic
1112345874 13:98589102-98589124 CTTCCATCTCTTCTGGATCTTGG - Intergenic
1113192490 13:107765707-107765729 CTTGCATCATTTATGAAACCTGG + Intronic
1115587287 14:34827342-34827364 GTTCCATCCATTATGGAAGATGG + Intronic
1118425460 14:65655706-65655728 CTTCCATCAATTATTGAAAGAGG - Intronic
1121209010 14:92192609-92192631 CTTGCATCACCAATAGAACATGG + Intergenic
1125457147 15:39871418-39871440 CTTCCATCTCTTATCACACAGGG + Intronic
1126235834 15:46383106-46383128 CTTCAATCAGTCATTGAACATGG - Intergenic
1126751253 15:51878822-51878844 CTTCAATCTTTTCTGGAACAAGG + Intronic
1127901130 15:63341730-63341752 ATTCCATGCCTTATGCAACAGGG + Intronic
1128943804 15:71808561-71808583 TTCCCATCTCTTCTGGAACACGG - Intronic
1131775262 15:95788466-95788488 TTTTTATCACTTATGGTACACGG - Intergenic
1132578894 16:676220-676242 CTCCCAGCACTTTTGGGACAGGG - Intronic
1132654945 16:1037830-1037852 CTCCCAGCACTGATGGAAGAGGG + Intergenic
1133451899 16:5910852-5910874 CTTCCATCTGTCACGGAACAGGG - Intergenic
1137899035 16:52245212-52245234 CATCCATCAGTTATTGAATAAGG + Intergenic
1140716551 16:77731328-77731350 TTTCCATCAATGATGGACCATGG + Intronic
1140904456 16:79398522-79398544 CTTCCAGGACTCATGGAACCAGG + Intergenic
1142888010 17:2925223-2925245 CTTGCATCACTTTTGGAGGAAGG - Intronic
1151712685 17:75815583-75815605 CAGACATCACTAATGGAACATGG + Intronic
1152326709 17:79645714-79645736 CCTCCTTCACTTAAGGCACAGGG + Intergenic
1153170008 18:2305050-2305072 CTTCCATCTATTAAGGAGCAGGG - Intergenic
1155609834 18:27654002-27654024 CTTCCATCACTTAGACTACAAGG + Intergenic
1158056645 18:53288420-53288442 TTTCCCTCAATTATGCAACATGG - Intronic
1164294852 19:23900891-23900913 CATCCATCACCTATGAAATAGGG + Intergenic
1164403028 19:27915534-27915556 CTTCCATCACTTTTACAATATGG + Intergenic
925649845 2:6078227-6078249 CTTCCCTCCCTTAGGTAACAGGG + Intergenic
929586861 2:43121784-43121806 CTTCCATCCCATCTGGAACCAGG - Intergenic
933875785 2:86620699-86620721 AATCCATCTCTTATAGAACAGGG + Intronic
936691238 2:114891783-114891805 CTTCAATCACTCAAGGAAAAAGG - Intronic
942399063 2:175581702-175581724 TTTCCATCAGTCATGGAAAATGG + Intergenic
947090982 2:226511132-226511154 CATCAATCAGTCATGGAACATGG + Intergenic
948535866 2:238646329-238646351 ATCCCATCACTTTTGGACCATGG - Intergenic
1171567943 20:26212113-26212135 CTTACATCACTGTTGGCACATGG - Intergenic
1173722994 20:45276494-45276516 CTTCCCTCTATTATGGTACATGG - Intergenic
1181577710 22:23805933-23805955 CTTGCATCCTTTCTGGAACAGGG - Intronic
1183536077 22:38402152-38402174 CTTCCAACCCTTATGGAAGGAGG - Intergenic
1183859736 22:40661257-40661279 CTTCCAGGACTTCTGGAACAAGG - Intergenic
1184505243 22:44896839-44896861 TTTCTGTCACTTATGAAACAGGG + Intronic
950157426 3:10733169-10733191 CATCCATCAGCTATGGAACAAGG + Intergenic
951416327 3:22426801-22426823 GTTCTATCACTTATGGAGCAAGG - Intergenic
953482640 3:43264868-43264890 CTTTCCTCATTTATGGGACAGGG - Intergenic
955797376 3:62651847-62651869 ACTCCATCAGTTATGGAATAGGG - Intronic
957871031 3:86090728-86090750 CACCCATCCCTTATGGCACATGG + Intergenic
958921907 3:100116519-100116541 CCTCCATCCATTATGGAAAATGG + Intronic
960195976 3:114768763-114768785 CTTCCCTCGCTTATGAAAAAAGG - Intronic
960501087 3:118439255-118439277 CTTCCTCCACTTCTGTAACATGG - Intergenic
961192116 3:124970674-124970696 CTTTCATCACTGATGAAAGACGG + Exonic
961847440 3:129778412-129778434 GTTCCATCACTGATGAAATAAGG + Intronic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
974227837 4:59070656-59070678 CTTCCATCACTATTAGAGCAAGG - Intergenic
974907816 4:68078838-68078860 TTTCCATCACTCAGGGAACAGGG + Intronic
975714576 4:77193368-77193390 CTTCCAGCACTTAGACAACATGG - Intronic
977511865 4:97972145-97972167 TTTCCTTAACATATGGAACATGG + Intronic
978370770 4:108027717-108027739 CTTCCATGAGGTATGGAACCAGG - Exonic
979230478 4:118343437-118343459 TTTCCTTCACATATGGAATATGG - Intronic
980165097 4:129216235-129216257 CTTCCTTCACTCATTCAACATGG + Intergenic
982177742 4:152722158-152722180 CTTCCCTCACCTATAAAACAAGG + Intronic
985806639 5:2049215-2049237 CTTCCAGCTCTGAAGGAACACGG - Intergenic
986719044 5:10546994-10547016 CTTCCATAAATGAAGGAACAAGG - Intergenic
987622213 5:20349118-20349140 ATTCCTTTAGTTATGGAACAAGG - Intronic
987982317 5:25101917-25101939 CATTCATCATTTATGGAAAAAGG - Intergenic
988586020 5:32508207-32508229 CTTCCAGCTCTGATGGAAAACGG - Intergenic
988979836 5:36556126-36556148 CTACCACCATTTATGGAATAGGG + Intergenic
991267212 5:64734977-64734999 CTTCCATAACATAAGAAACAAGG - Intronic
991433671 5:66573829-66573851 CTTCCTTCATTTATGCAACTGGG + Intergenic
992401135 5:76412817-76412839 CTTCCATCCCCTGTGGAACCTGG + Intronic
992864316 5:80942146-80942168 CTTCCTTCACTCAAGGATCATGG - Intergenic
993505880 5:88708079-88708101 TGTCTATCACTGATGGAACAGGG + Intergenic
993951442 5:94180959-94180981 CTTCCACCACTTGTGGTTCATGG + Intronic
994038125 5:95225956-95225978 CATCCATCTCTTAGGGAATAGGG - Intronic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
1001541388 5:172542360-172542382 CTTTCCTCATTCATGGAACAAGG + Intergenic
1009458235 6:63881721-63881743 TTTCCATTACTTATAGAATAGGG + Intronic
1009588130 6:65632822-65632844 ATTTCTTCACCTATGGAACATGG - Intronic
1012896986 6:104960338-104960360 TGTGCATCACTTATGGAATAAGG + Intronic
1013400218 6:109787089-109787111 CTTCCATAACTTATGTGGCATGG + Intronic
1018570730 6:165206891-165206913 CTGCCATTTCTTATGGCACAGGG - Intergenic
1019217307 6:170452203-170452225 CAACCAGCACTGATGGAACATGG + Intergenic
1021085346 7:16416276-16416298 CTACCAACATTTATGGAATAGGG - Intronic
1021860272 7:24899111-24899133 CATCCATTTCTTATGGGACATGG + Intronic
1022650387 7:32268504-32268526 CTTAAATCTCTTTTGGAACAAGG - Intronic
1023910365 7:44551111-44551133 GTTCCATCAATTATTGAAAATGG - Intergenic
1024423008 7:49191828-49191850 CTTCCAATAATTATGAAACAGGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026676478 7:72432694-72432716 CTTGCATCCTTTCTGGAACAAGG + Intronic
1028278499 7:88890008-88890030 CCAGCATCACTTATTGAACAAGG + Intronic
1032777262 7:135126776-135126798 CCAGCATCACTTATTGAACAGGG - Intronic
1035003540 7:155637228-155637250 CTTATCTCACTTATGGAAAAAGG - Intronic
1040923786 8:52653944-52653966 CTTCCCTTACTCGTGGAACAAGG + Intronic
1041082542 8:54227174-54227196 CTTCCTCCACCTATGGAATAGGG - Intergenic
1043551326 8:81376206-81376228 CATCCATCCCTTCTGGAATAGGG - Intergenic
1048497077 8:134944153-134944175 CTTCCATCTCTTCTGCAACGAGG - Intergenic
1048751328 8:137679675-137679697 CTTAGATCACTTATGCAACAGGG + Intergenic
1050470319 9:5981743-5981765 CGTCCATCTCTTCTGGAAAATGG + Intronic
1052845571 9:33333197-33333219 CTTCCATCACTTTTCCAAAAAGG - Intronic
1185534809 X:852570-852592 CTCCAATAACTTATGGAAAAGGG - Intergenic
1185741837 X:2539816-2539838 ATTCCATGACTAATTGAACAAGG - Intergenic
1185749151 X:2596771-2596793 CATCCATAAATTATGGAAGAGGG - Intergenic
1186878656 X:13842104-13842126 CTTTGATCTCTCATGGAACAAGG + Intronic
1187522135 X:20023105-20023127 CTTCCATACTTTCTGGAACAAGG - Intronic
1190052358 X:47159735-47159757 ATCCCAGCACTTATTGAACAGGG - Intronic
1193364610 X:80616896-80616918 CTTTCATCAGTTCTGGAAAAAGG + Intergenic
1196857172 X:119995197-119995219 ACTCCATCACTTATGGGAAATGG + Intergenic
1197453246 X:126644038-126644060 CTAGCATCACTTATTGAATAGGG - Intergenic