ID: 995408699

View in Genome Browser
Species Human (GRCh38)
Location 5:111830976-111830998
Sequence ATGGAAGGAATTCTCCTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995408696_995408699 -8 Left 995408696 5:111830961-111830983 CCTGTTCCATAAGTGATGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 99
Right 995408699 5:111830976-111830998 ATGGAAGGAATTCTCCTATATGG 0: 1
1: 0
2: 1
3: 13
4: 154
995408695_995408699 -7 Left 995408695 5:111830960-111830982 CCCTGTTCCATAAGTGATGGAAG 0: 1
1: 0
2: 1
3: 6
4: 125
Right 995408699 5:111830976-111830998 ATGGAAGGAATTCTCCTATATGG 0: 1
1: 0
2: 1
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995408699 Original CRISPR ATGGAAGGAATTCTCCTATA TGG Intronic
904579461 1:31530455-31530477 TTGGAAGGAATTCCCCAAGAGGG + Intergenic
905902936 1:41593871-41593893 AGGAAAGGGATTCTCCTCTAGGG - Intronic
906025238 1:42667910-42667932 ATGCAAGGCATTCACCTATGAGG - Intronic
907947650 1:59150339-59150361 ATGGATGGAATTCACCTAAAAGG + Intergenic
909832802 1:80214484-80214506 AAGGTAGGAAATCTCCTAAATGG - Intergenic
910096783 1:83532166-83532188 ATGGAATGACATCTCCTCTAAGG + Intergenic
912172755 1:107120713-107120735 GTGGTAGGAATTTTCCTCTAAGG + Intergenic
913358370 1:117949554-117949576 ATGGTAGGAATTTTCACATAAGG + Intronic
913552340 1:119927847-119927869 ATGGGAGGGATTCTGCAATATGG - Intronic
913968478 1:143395929-143395951 AAGGAATGGATTCTCCTCTAGGG + Intergenic
914062856 1:144221525-144221547 AAGGAATGGATTCTCCTCTAGGG + Intergenic
914116294 1:144744829-144744851 AAGGAATGGATTCTCCTCTAGGG - Intergenic
914373316 1:147050533-147050555 AAGGAAGGAAGTCACCCATATGG + Intergenic
914854476 1:151341238-151341260 AGGGAAGCCATTCTCCTCTAGGG - Exonic
916806487 1:168265958-168265980 AGGGAAGGAATCCTCCTCTGGGG - Intergenic
918356726 1:183711619-183711641 ATGGAATGAATTCCCCTCCAAGG - Intronic
920922603 1:210310962-210310984 ATCAAGAGAATTCTCCTATAAGG + Intergenic
921262260 1:213394736-213394758 CTGGAAGAAATTCTCCTCTGTGG + Intergenic
921790006 1:219279030-219279052 CTGGAAGGAATCCCCCTACAAGG - Intergenic
922623776 1:227015832-227015854 ATGGGAGAAATTCTCCAATATGG + Intronic
924708068 1:246513922-246513944 ATGGAAGGACATCTCCTGGAGGG + Intergenic
1063494582 10:6495143-6495165 ATGGAAGGAATCCTCCAAGCGGG - Intronic
1065655671 10:27946895-27946917 ATGGAAGAAATTTTCTTAAATGG - Intronic
1068161511 10:53271376-53271398 ATGGCAGGAATTGTCATATTGGG - Intergenic
1068498206 10:57812269-57812291 ATGTAAGGAATTATGCTAAATGG - Intergenic
1069693806 10:70372302-70372324 ATGGAAGGAAATAACCAATATGG - Intronic
1071977449 10:90969268-90969290 ATGGATGGAATTTACCGATAGGG - Intergenic
1072761659 10:98061865-98061887 ATGGTAGGGATTATTCTATATGG - Intergenic
1074624059 10:115159300-115159322 ATAGAAGGAATTCTCCTAAAGGG - Intronic
1075929517 10:126283846-126283868 AGGGAAGGATTTCTCAAATAAGG - Intronic
1077265933 11:1650171-1650193 AAGGAAGGAATTCTCCCTTCAGG - Intergenic
1078255355 11:9654010-9654032 ATGGAAGGAAGTTTCCAAGAGGG + Intergenic
1079930672 11:26556226-26556248 ATGCTAGGAATTCTCATTTAAGG + Intronic
1087081211 11:94172769-94172791 ATGCAATGAATTGTCCTATGAGG - Intronic
1087891551 11:103542848-103542870 AGGGAAGGAATCCTCCTTTAGGG - Intergenic
1089172142 11:116519802-116519824 CTACCAGGAATTCTCCTATAGGG - Intergenic
1090154993 11:124427898-124427920 ATGAGAGCAATTTTCCTATAGGG - Intergenic
1090927640 11:131263021-131263043 ATGCAAGGAGTTCTCCTAGGTGG - Intergenic
1094100481 12:26757063-26757085 ATGTCAGGAATTACCCTATATGG + Intronic
1095194122 12:39292662-39292684 AAGGAAGAGATTTTCCTATAAGG - Intergenic
1098220970 12:68269543-68269565 ATGGAAGGGACTGTCTTATAAGG + Intergenic
1098662809 12:73119617-73119639 ATTGAAAGCATTATCCTATAAGG + Intergenic
1100169181 12:91953742-91953764 ATGAAAGCAATTCTCAAATAAGG - Intergenic
1104344880 12:127987029-127987051 AAGAAAGGAATGTTCCTATAGGG - Intergenic
1105935743 13:25096670-25096692 ATGAACGGAATGCTCCTAAATGG + Exonic
1106524479 13:30527865-30527887 ATGGAAGGCATTCTACTATGGGG - Intronic
1109167879 13:59058104-59058126 ATGGAAAGAATTAACCTGTATGG + Intergenic
1109825077 13:67708425-67708447 ATGGAAGGGAATGTGCTATAGGG + Intergenic
1110823375 13:79942481-79942503 ATGGTAGGAATTAACCTAAAAGG + Intergenic
1112057496 13:95704171-95704193 TTGGAAGCATTTCTCCTTTAAGG + Intronic
1112463425 13:99622659-99622681 ATGGATAGAGTTCTCCTTTAGGG - Intronic
1117473215 14:56067649-56067671 TTGGAAGGCATTCTCCTTGATGG - Intergenic
1127924274 15:63523525-63523547 AGGGAAGGAATTCTTCTCGAAGG + Intronic
1131017508 15:89070333-89070355 CTGGAAGGAACACTCCTAGAGGG + Intergenic
1131040276 15:89258256-89258278 AAGGAAGGAAATTTCCTCTAGGG - Intronic
1131877954 15:96830962-96830984 ATGGAAAGAATTCTCTTATTTGG + Intergenic
1139562508 16:67752391-67752413 AAGGAATGAATTCTCCCCTAGGG + Intronic
1141275615 16:82585231-82585253 ATGGAAGGTATTTTTCTTTAAGG + Intergenic
1144057522 17:11556123-11556145 TTGGAAGGCCGTCTCCTATAGGG - Intronic
1147406777 17:40218075-40218097 ATGGAAGGAGGTTTCCTAAATGG - Intergenic
1150331425 17:64297453-64297475 ATGCCAGGAATTCTCCAAGAGGG - Intergenic
1152506409 17:80751945-80751967 ATGGAAAGCATTCTGCTGTAGGG - Intronic
1159390306 18:67784388-67784410 ATGAAATGAATTCTCCTACAGGG + Intergenic
1163109176 19:15148356-15148378 ATGGGAAGAATTCTCATATATGG + Intergenic
1168583130 19:57571781-57571803 AGGGAAGGAATTCCCCTTAAAGG + Exonic
1202702266 1_KI270712v1_random:173397-173419 AAGGAATGGATTCTCCTCTAGGG + Intergenic
925103272 2:1267516-1267538 TTGGAAGGACTTCTCCCACATGG - Exonic
925629676 2:5878095-5878117 ATGCAACGCATTCTCCTAAAAGG + Intergenic
925957564 2:8982594-8982616 ATGGAGGGAATTCTCCAAGGTGG - Intronic
926437098 2:12849315-12849337 AGGGAAAGAATTCTCATAGAGGG + Intergenic
926965802 2:18409363-18409385 TTGGCAGGAATTATCCTGTAAGG - Intergenic
928886977 2:36160991-36161013 ATGGAAGGAATTCTAAAAGAAGG + Intergenic
929239096 2:39635461-39635483 TTGTAAGGAATTCTCATATTAGG + Intergenic
933571444 2:84018143-84018165 CTGAAAGTAATTCTCCCATAAGG - Intergenic
934173180 2:89556844-89556866 AAGGAATGGATTCTCCTCTAGGG + Intergenic
934283496 2:91631201-91631223 AAGGAATGGATTCTCCTCTAGGG + Intergenic
935720198 2:105973002-105973024 ATGGAAAGACTTCTCCTTTTAGG - Intergenic
937315468 2:120929485-120929507 GTGGTTGGAATTCTCCTGTAAGG + Intronic
937693114 2:124778654-124778676 ATGGAAGAAACTCTCCAAAAGGG + Intronic
940108173 2:150121720-150121742 ATGGGCTGAATTCTCCTATTTGG + Intergenic
943271309 2:185809249-185809271 ATGCAACTAATTCTCCTATTGGG - Intronic
943444145 2:187962637-187962659 GTAGAAGGAATTCTCCTGAAAGG + Intergenic
946507911 2:220321380-220321402 AAGGAAGGAATGCTTCTATGTGG + Intergenic
947311034 2:228802455-228802477 TTGGAAGCATTTCTCCTAGATGG - Intergenic
947752915 2:232542022-232542044 ATGGAAAGACTGCTCCTCTAAGG - Intronic
948075875 2:235164888-235164910 ATGGAAAGAAGGCTCCTACAAGG - Intergenic
948127496 2:235575485-235575507 CTGGAAGGCTTTCTCCTTTAAGG + Intronic
1175472099 20:59237655-59237677 ATGGAAGTTATTCTCCTTTGAGG + Intronic
1175818251 20:61894949-61894971 ATGGAAGGAAATCTCAACTATGG + Exonic
1176657180 21:9597558-9597580 ATGGAAGGCATTCTACTAGTTGG - Intergenic
1181148960 22:20869298-20869320 GAAGAAGGAATTCTCCTTTAGGG + Intronic
1183090716 22:35520044-35520066 CTGGAAGGAACTCTCCTTTCTGG - Intergenic
1184216556 22:43071217-43071239 ACGGCAGGAATACTTCTATAGGG + Intronic
949276663 3:2291320-2291342 ATAGTGAGAATTCTCCTATATGG - Intronic
950740804 3:15050435-15050457 AGGGAAGGAATACTCTCATAAGG + Exonic
951226948 3:20131464-20131486 ATGGAAGCACTTCTTCAATATGG + Intronic
952234096 3:31461282-31461304 AAGAAAGGAATTCTCCCTTATGG + Intergenic
954104172 3:48400215-48400237 ATGGAAGGAATTTAAATATAAGG - Intronic
956556702 3:70531905-70531927 ATGGAAGGTAGTCTCCAATTTGG - Intergenic
956576973 3:70762717-70762739 AAGGAACTAATGCTCCTATATGG - Intergenic
956872156 3:73428624-73428646 AAGGAAGGAAAACTCCTTTATGG + Intronic
959862570 3:111232313-111232335 ATGGAAAGATTTCTTCTAAAAGG + Intronic
960910844 3:122647860-122647882 ATGGGAGGATTTCTCTTATTTGG - Intergenic
962124191 3:132597976-132597998 ATGAAAGCAATTCTTCTATGTGG + Intronic
962678372 3:137772507-137772529 ATGGAAAAAAATCTCCTAAAAGG - Intergenic
964099375 3:152970109-152970131 ATGTAAGGCATTGTCCTAGATGG - Intergenic
964847866 3:161063108-161063130 ATAGCATAAATTCTCCTATAAGG - Intronic
965506147 3:169517507-169517529 AGGGAAGGAAATGTCCTCTAGGG + Intronic
965796350 3:172443514-172443536 ATGGCAGGAATTTCCCTAAATGG + Intergenic
966900595 3:184481220-184481242 AGGAAAGGAATTATCATATAAGG + Intronic
968752693 4:2398459-2398481 ATGGCAGGTTTTCACCTATATGG + Intronic
969827035 4:9765706-9765728 AAGGAATGGATTCTCCTCTAGGG + Intergenic
971396068 4:26228688-26228710 ATGCAAGGAATTCTCCCGTAGGG + Intronic
971512310 4:27442431-27442453 ATGGTAAGAATTCTTCTACATGG - Intergenic
972080005 4:35138772-35138794 ATGGAAGAAATTGACCTAAATGG - Intergenic
975217185 4:71769353-71769375 CTGCAAGGAATTCTCCCATCTGG - Exonic
976473954 4:85461345-85461367 CTGGAAAGAATTCTCCAATGTGG - Intergenic
976811959 4:89108078-89108100 AAGGAAGGAATCCTCCTCCAGGG + Intronic
977575134 4:98666634-98666656 AGGGAAGGAACTCTCCTCTGGGG - Intergenic
978650003 4:110990946-110990968 ATAGGATTAATTCTCCTATAAGG - Intergenic
980408752 4:132387051-132387073 ATGGATGGAATTCACCTAGAAGG + Intergenic
983512290 4:168621684-168621706 ATGAAAGGAATTTTACTAAATGG + Intronic
985418246 4:189758571-189758593 ATGGAAGGCATTCTACTAGTTGG + Intergenic
985712046 5:1434978-1435000 TTGGAAGGTCTTCTCCTATGTGG + Intronic
986999850 5:13649163-13649185 AGGGATGGAATTCTCCAAGATGG + Intergenic
990494324 5:56332391-56332413 AAGGAATGCATTCTCCTCTAGGG + Intergenic
994735545 5:103550046-103550068 TTGAAAGGAATTCTCCTCAAAGG - Exonic
994954688 5:106512856-106512878 ATGGAGAGATTTCTCCTTTAGGG + Intergenic
995310372 5:110703691-110703713 TTGGAAGGAATTCCCCAAGAGGG - Intronic
995408699 5:111830976-111830998 ATGGAAGGAATTCTCCTATATGG + Intronic
996272300 5:121621181-121621203 CTGGAAGTAATGCTCCCATATGG - Intergenic
999483007 5:151966119-151966141 AAGCATGGAATTCTCCTCTAAGG + Intergenic
1012817054 6:104037389-104037411 ATGGAAGGAATTCTAGTTTTGGG + Intergenic
1013207084 6:107955122-107955144 ATGTAAGTAATTTTCCTGTATGG - Intronic
1013545300 6:111151016-111151038 ATGGATGGAAGTGTCCTAAAAGG - Intronic
1013666935 6:112358831-112358853 ATGTAGGGAATCATCCTATATGG - Intergenic
1013997678 6:116327060-116327082 ATGGATGGCTTTCTCCTAGAGGG + Intronic
1014182394 6:118399725-118399747 ATGGTATAAATACTCCTATATGG - Intergenic
1016301006 6:142631846-142631868 ATGGAAGGAAGTCACATATATGG - Intergenic
1017063056 6:150504338-150504360 ATGGAAAGATTACTCCTAGATGG - Intergenic
1019341189 7:509901-509923 ATGGAAGGAAGTCTGCTGTCTGG + Intronic
1020737153 7:11965044-11965066 TTGGAAGTAAGTCTCCTATTTGG + Intergenic
1020854165 7:13396078-13396100 ATTGAAGGACATTTCCTATATGG + Intergenic
1023257854 7:38329624-38329646 ATGGAATGAATTCTGCTGCAGGG + Intergenic
1023661903 7:42478758-42478780 TGGGAAGGAAATCTCCTTTAGGG - Intergenic
1023814365 7:43938337-43938359 CTGGAAGGAATTCTCCTGGTGGG - Intronic
1024773736 7:52757573-52757595 ATAGCAGAAATTCTCCTAGAAGG + Intergenic
1025886980 7:65605001-65605023 ATGGATCAAATCCTCCTATAGGG + Intergenic
1030464554 7:109883935-109883957 ATGGAAGGAATTCTAGTTTTAGG + Intergenic
1031855433 7:126916922-126916944 ATGGATCAAATCCTCCTATAGGG - Intronic
1032505793 7:132433822-132433844 ATGGAGGGAATTTTCCAATATGG - Intronic
1036403536 8:8432438-8432460 CTGGAAGGAATTCTCTGATTGGG + Intergenic
1037654031 8:20867659-20867681 TTGGATGGAATTCTCCTTTCAGG + Intergenic
1038072614 8:24034439-24034461 CTGGAATGAATTCTCCTCTCAGG + Intergenic
1040874342 8:52134894-52134916 ATGGAAGAAATTTTCTTGTATGG + Intronic
1041370408 8:57153671-57153693 ATGGAGGGAATTCTCTCATGTGG + Intergenic
1042010089 8:64234396-64234418 ATAGAAGGCATTCTCCTTTAGGG + Intergenic
1043468663 8:80539677-80539699 AAGGAAGGCATTCTGCTAGAGGG - Intergenic
1045421823 8:102023911-102023933 ATAAAAGGAATTCTCCTAAGTGG + Intronic
1047470581 8:125167674-125167696 ATGGAAGAAATTATGCTAAAGGG + Intronic
1049915962 9:318877-318899 ATGGCAGAAATTCTCCTCTATGG + Intronic
1058314633 9:103549868-103549890 ATTGAAGGAGTTCTCTAATATGG + Intergenic
1058993733 9:110279442-110279464 ATGGAAGAAAGTCTCCAAGATGG + Intergenic
1203634902 Un_KI270750v1:101132-101154 ATGGAAGGCATTCTACTAGTTGG - Intergenic
1194591070 X:95800377-95800399 ATGGAAGCAATTGTCCAGTATGG - Intergenic
1197472355 X:126879048-126879070 ATGGAAATAATTTTACTATAAGG + Intergenic
1198416571 X:136426050-136426072 ATGGAAGGATTCCTCTTAGAAGG + Intergenic
1198733462 X:139759852-139759874 ATGGAAGGAATGCTCTGTTAAGG - Intronic
1201575288 Y:15456034-15456056 ATGGAAGGACTTCTTCTGGATGG - Intergenic