ID: 995408700

View in Genome Browser
Species Human (GRCh38)
Location 5:111830977-111830999
Sequence TGGAAGGAATTCTCCTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995408696_995408700 -7 Left 995408696 5:111830961-111830983 CCTGTTCCATAAGTGATGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 99
Right 995408700 5:111830977-111830999 TGGAAGGAATTCTCCTATATGGG No data
995408695_995408700 -6 Left 995408695 5:111830960-111830982 CCCTGTTCCATAAGTGATGGAAG 0: 1
1: 0
2: 1
3: 6
4: 125
Right 995408700 5:111830977-111830999 TGGAAGGAATTCTCCTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995408700 Original CRISPR TGGAAGGAATTCTCCTATAT GGG Intronic
No off target data available for this crispr