ID: 995409396

View in Genome Browser
Species Human (GRCh38)
Location 5:111837861-111837883
Sequence GGGTCGTCACCTCATTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995409392_995409396 27 Left 995409392 5:111837811-111837833 CCTTCTGGTCACAAAGAGGAAAA 0: 1
1: 0
2: 0
3: 31
4: 341
Right 995409396 5:111837861-111837883 GGGTCGTCACCTCATTCCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995409396 Original CRISPR GGGTCGTCACCTCATTCCAG TGG Intronic
900366149 1:2312751-2312773 GGCTCCGCACCTCCTTCCAGCGG - Intergenic
903846205 1:26281016-26281038 GGGTGGTCACCTGAATGCAGGGG - Intronic
908112671 1:60912550-60912572 GGGTGGTCACATTATTCCAGAGG + Intronic
923141239 1:231162739-231162761 GGGTCCTCACCTCCTGCCCGAGG - Intronic
1064481242 10:15742939-15742961 GGGACCTCACCACATCCCAGGGG - Intergenic
1066157109 10:32690085-32690107 GGGGTGACATCTCATTCCAGAGG - Intronic
1080054232 11:27888864-27888886 GTGTCGTCATCTCCTTCGAGGGG + Intergenic
1081754202 11:45532982-45533004 TGGTCCTCACCTCTTCCCAGGGG + Intergenic
1084155218 11:67309472-67309494 GGGCCGACTCCTCATCCCAGAGG - Exonic
1094765966 12:33594923-33594945 GGGTCATCACGTCATTGCAATGG - Intergenic
1097697257 12:62786626-62786648 GGGTGGTCAACTCCTTCCTGGGG + Intronic
1101245821 12:102883693-102883715 GGGTGCTCACCTGAGTCCAGGGG + Intronic
1106049168 13:26174752-26174774 GGGAGGTCCTCTCATTCCAGGGG - Intronic
1113199847 13:107855068-107855090 GAGTGGTCACCTCTTTGCAGAGG + Intronic
1119569994 14:75661529-75661551 GGGTCGTCCCGTCCTTCCCGGGG + Intronic
1122486120 14:102081737-102081759 GTGTCGTCATCTCCTTCAAGGGG + Exonic
1127512615 15:59657506-59657528 GGGTCGTCAGCTCAGTTCTGCGG - Exonic
1144085032 17:11800664-11800686 GTGTGGTCACCTCACTACAGAGG - Intronic
1145980745 17:29010025-29010047 GGGCTGCCACCTCACTCCAGAGG + Intronic
1151057444 17:71049573-71049595 GGGTTGAGTCCTCATTCCAGAGG - Intergenic
1152422200 17:80199958-80199980 TGGGCTTCACCTCATTCCAGAGG + Intronic
1157936105 18:51874576-51874598 GGGGCCTCACCCCATTCCAGAGG + Intergenic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
1165431042 19:35773144-35773166 GGTTCTACAGCTCATTCCAGTGG + Intergenic
927871920 2:26629283-26629305 GGATGGTCACCTCACTCCAAGGG - Intronic
928483463 2:31706795-31706817 GGGTCAACACCTGATCCCAGAGG - Intergenic
930763720 2:55062659-55062681 CTGTCATCACCTCAATCCAGGGG - Intronic
949030825 2:241796513-241796535 GAGTCGTCACCCCATTTCTGTGG + Intronic
1176428270 21:6561771-6561793 GGGCAGTGACCTCATTCCACAGG + Intergenic
1179703760 21:43170087-43170109 GGGCAGTGACCTCATTCCACAGG + Intronic
1181282124 22:21727756-21727778 GGGTCGTCGCCCCATCCCTGGGG + Intronic
953344947 3:42167516-42167538 GGGCCCTCACCCCGTTCCAGTGG + Intronic
954929413 3:54268331-54268353 GGGTCCACACCTCAGTGCAGTGG - Intronic
955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG + Intronic
960295875 3:115943420-115943442 GGGTGGTCACCTCAGTGAAGAGG - Intronic
977294387 4:95194519-95194541 GGGTCTTCTCCACCTTCCAGAGG + Intronic
985389001 4:189475149-189475171 GTGTCGTCATCTCCTTCGAGGGG - Intergenic
989467339 5:41772634-41772656 GGGTCATCAACTGAATCCAGAGG - Intronic
995409396 5:111837861-111837883 GGGTCGTCACCTCATTCCAGTGG + Intronic
1002181360 5:177432705-177432727 GGGTCCTGACCTCATCCCTGAGG + Exonic
1005290607 6:24375207-24375229 GGTTTTTCACCTCATTCCACAGG - Intergenic
1007851140 6:44803824-44803846 GGGTCCTTGCATCATTCCAGTGG + Intergenic
1010914109 6:81594749-81594771 GGGTACTAATCTCATTCCAGAGG - Intronic
1012500625 6:99884303-99884325 GTGTCGTCACCTGTGTCCAGGGG - Intergenic
1018246190 6:161826567-161826589 GGTTGGTCACCTCCTTCCATAGG - Intronic
1018383832 6:163285089-163285111 GGGTGGTCACCTTATTCTAAGGG - Intronic
1020006560 7:4786480-4786502 GGCTCCTCCCCTCTTTCCAGCGG + Intronic
1035037921 7:155907451-155907473 GGTTCTTCACCTCCTGCCAGGGG + Intergenic
1046659796 8:116937491-116937513 GTGTCATCACCAAATTCCAGTGG - Intergenic
1199693797 X:150329122-150329144 GGCCAGTCACCTGATTCCAGGGG + Intergenic