ID: 995410038

View in Genome Browser
Species Human (GRCh38)
Location 5:111846590-111846612
Sequence GAGGGCTGCCTGGATACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995410031_995410038 17 Left 995410031 5:111846550-111846572 CCAGTGGAGCTGACCTTCTCTTG 0: 1
1: 0
2: 0
3: 9
4: 190
Right 995410038 5:111846590-111846612 GAGGGCTGCCTGGATACTGCTGG 0: 1
1: 1
2: 3
3: 21
4: 243
995410033_995410038 4 Left 995410033 5:111846563-111846585 CCTTCTCTTGAGCATCTTGGTAG 0: 1
1: 0
2: 0
3: 3
4: 134
Right 995410038 5:111846590-111846612 GAGGGCTGCCTGGATACTGCTGG 0: 1
1: 1
2: 3
3: 21
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995410038 Original CRISPR GAGGGCTGCCTGGATACTGC TGG Intronic
900526508 1:3131813-3131835 GAGAGCTGCCTGGAGACCCCAGG - Intronic
900566864 1:3337601-3337623 GAAGGCTGCTTGGCCACTGCGGG + Intronic
900660197 1:3778287-3778309 TCGGGCTGCCTGGATACCCCAGG - Intergenic
903070136 1:20722980-20723002 GCAGGCTGCCTCGATGCTGCTGG - Intronic
905899422 1:41571445-41571467 AGGGGCTGCCTGGAAAATGCGGG + Intronic
906200069 1:43954277-43954299 GGGTGCTGCCTGGAGACAGCCGG - Intronic
915908719 1:159899172-159899194 GAGGGCTGTCAGGGTACTGAGGG - Intronic
916167739 1:161978589-161978611 GAGGGACGCCTGGATACCGACGG - Intergenic
920084943 1:203408610-203408632 GAGGACTGCCTGGATAAAGTTGG - Intergenic
923083335 1:230681227-230681249 AGTGGCTGCCTGGAAACTGCAGG + Intronic
1065319502 10:24495967-24495989 GAGGCCTGGCTTGAGACTGCTGG - Intronic
1066466328 10:35653573-35653595 GAAAGCTGCCAGGAGACTGCTGG - Intergenic
1068113811 10:52713800-52713822 GAGGGCCTCTTGGTTACTGCTGG + Intergenic
1069749542 10:70736492-70736514 GAGGGGTCCCTGGAGGCTGCCGG + Intronic
1070720248 10:78752001-78752023 GAGGCCAGCCTGCACACTGCAGG - Intergenic
1071129051 10:82370366-82370388 GAGGGATGTCTGGATGCTGAGGG - Intronic
1071739773 10:88343996-88344018 AAGGGGTGGCTGCATACTGCTGG - Intronic
1073432114 10:103493749-103493771 GAGGGAATCCTGGAGACTGCCGG + Intergenic
1074302116 10:112242273-112242295 GAGGACTGCCTGGCTACTACTGG + Intergenic
1075087436 10:119422972-119422994 CAGGGCTACCTGGACACTGGTGG - Intronic
1075182597 10:120225291-120225313 GAGGGATGTCTAGACACTGCGGG - Intergenic
1075441071 10:122479795-122479817 GATGGCTGCGGGGATCCTGCAGG + Intronic
1075486855 10:122829520-122829542 GAGGGCTGCCTGAGGACTGAGGG - Intergenic
1075658403 10:124176441-124176463 GTGGGCAGCCTGGCTTCTGCTGG - Intergenic
1076456713 10:130604999-130605021 GAGGGTTGCATGGACATTGCAGG + Intergenic
1077225354 11:1437024-1437046 GAGGGCTGCCTGGATGGGGCTGG + Intronic
1077808274 11:5610964-5610986 GAAGACTGCCTGGATCCTGGGGG + Exonic
1077889120 11:6405928-6405950 GAGGGCTGGCTGGACACTTCTGG + Intronic
1078243524 11:9551992-9552014 GAGGGCTTCCTGGATCCCTCTGG - Intergenic
1079096323 11:17512764-17512786 GAGGGCTAGCTGGAAACTGCAGG + Intronic
1079356428 11:19733785-19733807 GAGGCCTACCTGGAGACTGTTGG + Intronic
1080390669 11:31842974-31842996 TAGGGCTGCCTGGACACGGAGGG - Intronic
1083047366 11:59748966-59748988 AAGGGCTGACTGCATCCTGCTGG + Intronic
1083581190 11:63826676-63826698 GAAGGCTGCCTGGCTTCAGCTGG + Intronic
1083619125 11:64040374-64040396 GAGGGCTGCATGGAGACCCCCGG + Intronic
1083698612 11:64459033-64459055 GAGAGATGCCTGGATTCTGAGGG - Intergenic
1084332920 11:68440175-68440197 GACGGCCGCCTGGATGCTGACGG - Intronic
1085481075 11:76823563-76823585 TAGTCCTGCCTGGACACTGCAGG + Intergenic
1085522315 11:77145948-77145970 GATGGCTGGCTGGTGACTGCGGG - Intronic
1087262473 11:96026241-96026263 CAGGGCTGCAGGTATACTGCTGG - Intronic
1088046524 11:105458338-105458360 GACCGCTGCCTGGTTTCTGCTGG - Intergenic
1088824753 11:113484165-113484187 GAAGGTTTGCTGGATACTGCTGG - Intergenic
1089294903 11:117461581-117461603 GGGGGCTGGCTGGGCACTGCAGG + Exonic
1089467129 11:118692577-118692599 GAGGGCTGCCTGCACACACCAGG + Intergenic
1091051210 11:132374255-132374277 GAGTACTGCCTGGGTATTGCAGG - Intergenic
1091963330 12:4717992-4718014 GAGGGCTGCCTCATTACTGATGG + Intronic
1093683516 12:22030399-22030421 GAGGGATGTCTGGATGCTGAGGG + Intergenic
1102262630 12:111453747-111453769 GAGGGCGGCCTGGGGACCGCCGG + Exonic
1103907814 12:124336253-124336275 GCCGGCTGCCTGGATGCTGTCGG - Intronic
1104031342 12:125067297-125067319 TAGGGCAGCCTGGAGACTCCTGG + Intronic
1104991270 12:132625109-132625131 GAGGGCTGGCTGCACACAGCAGG - Intronic
1107084067 13:36406629-36406651 TAGGGTTTCCTGGATGCTGCAGG + Intergenic
1108795761 13:54028370-54028392 GAGTGGTGTCTGCATACTGCAGG + Intergenic
1108858023 13:54819908-54819930 GAGTACTGCCTGGGTATTGCTGG - Intergenic
1109356982 13:61243430-61243452 GTGTGCTGCCTGTATACTACTGG - Intergenic
1109688586 13:65854464-65854486 GGGGTCTGCCTGCATACTGTCGG + Intergenic
1109808239 13:67471698-67471720 GATGGCTGACTGGATACACCTGG - Intergenic
1113059551 13:106307417-106307439 TAGGGCTGACTGGATAATCCAGG - Intergenic
1113796991 13:113064184-113064206 CACGTCTGCCTGGATGCTGCGGG - Intronic
1115036565 14:28864453-28864475 GATGGCTGCCTTGATTCTACTGG + Intergenic
1118077773 14:62319807-62319829 GAGGGCTGACTGACTTCTGCGGG + Intergenic
1118705557 14:68477295-68477317 GAGGGCTTCCTGGCTACAGATGG + Intronic
1118885062 14:69859463-69859485 GAGGGGAGCCTGGGGACTGCGGG - Intronic
1119197904 14:72731323-72731345 GAGGGATGGCTGGGCACTGCTGG + Intronic
1119690829 14:76671048-76671070 GAGTGCTGACTGGATAATTCTGG + Intergenic
1121345880 14:93135657-93135679 CAGGCCTGCCTGGATATTTCTGG - Intergenic
1121440701 14:93947313-93947335 GAGAGCTGCCTGGGTGCTGGCGG + Intronic
1121573088 14:94962147-94962169 GAGGGCTGCTTATGTACTGCAGG + Intergenic
1121750336 14:96349077-96349099 GTGGGCTGCCTTGAATCTGCAGG - Intronic
1122884634 14:104705603-104705625 CAGGGCTGCATGGATACAGGAGG - Intronic
1124931754 15:34126757-34126779 GAGGGCTGCCTGACTGCAGCAGG + Intergenic
1128816793 15:70615887-70615909 GGGTGCTACCTGGATGCTGCTGG + Intergenic
1128966229 15:72061176-72061198 GAGTACTGCCTGGCCACTGCTGG - Intronic
1129871327 15:78943838-78943860 GAGGGCTGCCTGGAGAAGGCTGG - Intronic
1133910089 16:10057760-10057782 AAAGTCTGCCTGGATACTGAAGG + Intronic
1134259197 16:12637266-12637288 GTGGGCTGCCTGGAAGCTGGAGG - Intergenic
1136996825 16:35196274-35196296 CATGTCTGCCTGGATGCTGCAGG - Intergenic
1138563460 16:57815902-57815924 GAGTGCTGCCCGGATACCCCGGG + Intronic
1139081305 16:63524966-63524988 GAGGGGTGCCTTGTTACTGCTGG - Intergenic
1140526163 16:75624662-75624684 TATAGCTGCCTGGATACTTCAGG + Intergenic
1141072884 16:80974053-80974075 GAGGGCTTCCGGGTTGCTGCTGG - Exonic
1141148229 16:81546953-81546975 GAGAGCTCCCTGGATGGTGCTGG + Intronic
1141763737 16:86045384-86045406 GAGGGCTGCATGGCTTGTGCTGG + Intergenic
1143352668 17:6299958-6299980 GAGAGGTGACTGGATACTGGGGG + Intergenic
1143723076 17:8827269-8827291 TCCGGCTGCCTGGATGCTGCAGG + Exonic
1144689073 17:17247759-17247781 GAGGTTTGCCTAGATCCTGCTGG - Intronic
1144956000 17:19019217-19019239 GGTGGCTCCCTGGATCCTGCAGG - Intronic
1145967232 17:28928262-28928284 GAGGGTTGCCTGGGCTCTGCTGG - Intronic
1146058941 17:29594425-29594447 GTGGGCTCCCTGGTTTCTGCTGG + Intronic
1147817002 17:43217498-43217520 TAGGGCTGTCTGGAAGCTGCTGG + Intronic
1148084846 17:44987875-44987897 GCTGGCTGCCTGGATGCTGGGGG + Intergenic
1148150676 17:45395080-45395102 GAGGGCTTCCTGGCTGCTTCTGG - Exonic
1149468517 17:56898036-56898058 GAGGGCTGGCTGCACACTGCTGG - Intronic
1150207584 17:63420599-63420621 GAGGGCTGGCCCGATACTGAGGG - Exonic
1150425604 17:65074748-65074770 GGGGGCTGCCTGCACACTGCTGG - Intergenic
1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG + Intronic
1152511128 17:80789619-80789641 CAAGGCTGCCTGGATATTGCAGG - Intronic
1153226119 18:2901311-2901333 CAGGGCTTCCTGGAGACAGCAGG + Intronic
1153356559 18:4143413-4143435 GAGTACTGCCAGGGTACTGCTGG + Intronic
1155032740 18:21998437-21998459 GACAGCTCCCTGGATGCTGCTGG - Intergenic
1156233997 18:35183401-35183423 GAGGGCTGCATTGCTGCTGCAGG + Intergenic
1157226156 18:45866546-45866568 GAGGGCTGCCAGCAAGCTGCTGG - Intronic
1161165018 19:2782146-2782168 GAGGCCGTCCTGGGTACTGCAGG + Intronic
1161510742 19:4669869-4669891 CAGGGGTGCCTGGACACTCCAGG + Intronic
1161619872 19:5292401-5292423 GAGGCCAGCCTGGGTTCTGCAGG + Intronic
1163260809 19:16188777-16188799 GAGGGCTGACTGGACACAGGAGG + Intronic
1165115234 19:33524446-33524468 GCTGGCTGCCTGGAGACGGCAGG + Intergenic
1165255460 19:34575241-34575263 AAGGCCTGCCTGGAGACTACAGG - Intergenic
1166102152 19:40577145-40577167 GAGGGAACCCTGGATCCTGCGGG + Intronic
1166266429 19:41687441-41687463 CAGGGCTCCCTCCATACTGCTGG + Intronic
1166293927 19:41879706-41879728 GAGGGCTACCTGGGTATTGGGGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166859069 19:45799273-45799295 GAGGGCTGCCAGGTGCCTGCGGG + Intronic
1167006992 19:46782636-46782658 GAGGGCTGCCTTGTCTCTGCTGG - Intronic
1167494494 19:49809567-49809589 GAGGGCTTCCTGGGTACGGGAGG + Exonic
1167735617 19:51292935-51292957 GAGGGTTGGCTGCACACTGCTGG - Intergenic
925992963 2:9268811-9268833 TAGGGCTGCCTGAGTGCTGCAGG + Intronic
926327124 2:11795076-11795098 AAGGGCTGCTTGGATTCTGGGGG - Intronic
927147159 2:20173712-20173734 GATGGCGGCCTGGCTAATGCAGG + Intergenic
928181607 2:29072252-29072274 GAGGGATGCCTTGAGCCTGCTGG + Exonic
929296684 2:40256298-40256320 GACGGCTGCCTGGATTCTAATGG + Intronic
931670298 2:64641372-64641394 GGGGGCGGCCGGGAGACTGCTGG + Intronic
934713411 2:96529782-96529804 GAGGGCTGCGTGGAGGCTGAAGG - Intergenic
934840178 2:97619580-97619602 ACTGGCTGCCTGGCTACTGCTGG - Intergenic
935591844 2:104852333-104852355 GGGGGCTGCCTGGCTGCGGCTGG + Intergenic
936329063 2:111531688-111531710 GAGGACTGCCTGGAGGCAGCAGG - Intergenic
936501795 2:113072531-113072553 CAGAGCTGCCTGGAGCCTGCTGG + Exonic
938405693 2:131031988-131032010 GAGGACGGCCTGGCTCCTGCTGG + Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
940107342 2:150114835-150114857 GAGGAATGCCTGGCCACTGCGGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941857017 2:170241665-170241687 GTGGACTGCCTGGATGCTGTGGG + Intronic
942482906 2:176407884-176407906 GAGGGCTGCATGTGGACTGCAGG + Intergenic
948562809 2:238865387-238865409 GAGGGGGGCCTGGATCCAGCCGG + Intronic
1170000515 20:11608785-11608807 GAGGGCTTCCTGGAGCCTGAAGG - Intergenic
1170550045 20:17468727-17468749 GTGGGCTGCCTGTCTACAGCAGG - Intronic
1173522541 20:43710486-43710508 AAGGGCAGCCTGCACACTGCAGG - Intronic
1173647357 20:44641713-44641735 GAGGTCTGCATGGCTACTTCTGG + Intronic
1175390830 20:58626247-58626269 TAGGGCAGCCTGGGTACTTCCGG - Intergenic
1176084365 20:63289367-63289389 GAGGGCTGCTTGGACCCTGGTGG + Intronic
1179100076 21:38348663-38348685 GAGGGATTCCTACATACTGCAGG + Intergenic
1179725222 21:43338226-43338248 GAGTTCAGCCTGGACACTGCGGG - Intergenic
1180042865 21:45288727-45288749 GGGAGCTGCCTGGAGGCTGCGGG - Intergenic
1180675075 22:17581222-17581244 GCGCGCTGCCTGGAGACTGGAGG - Intronic
1181065826 22:20305548-20305570 CAGGCCAGCCTGTATACTGCGGG + Intergenic
1181345818 22:22219934-22219956 GAGGGCTCCCTGGATTCTGTAGG - Intergenic
1181363007 22:22353235-22353257 GAGGACTCCCTGGCTTCTGCTGG - Intergenic
1181365818 22:22376307-22376329 GAGGACTCCCTGGCTTCTGCTGG - Intergenic
1181372253 22:22427837-22427859 GAGGGCTCCCTGGCTTCTGCTGG - Intergenic
1181396916 22:22629457-22629479 GCTAGCTGCCTGGATAGTGCTGG + Intergenic
1182115981 22:27756568-27756590 AAGGGCTCCCTGGGTACTCCGGG + Intronic
1182718234 22:32376970-32376992 GAGGGCTCCCTGGCTTATGCTGG - Intronic
1183671030 22:39272988-39273010 CAGGCCTGCCTGGATAATCCAGG + Intergenic
1184631210 22:45781366-45781388 GAGGGGTGCCTCACTACTGCTGG - Intronic
1185418716 22:50723304-50723326 GTGGGCTGCATGGATGCTGGCGG + Intergenic
950633120 3:14297491-14297513 GAGGGATACCTGGGGACTGCCGG + Intergenic
953469928 3:43157982-43158004 GAGGGCTGCCCGCAGCCTGCTGG + Intergenic
953877660 3:46675570-46675592 GAGGCCTCCCTGGACACGGCAGG + Intronic
953990102 3:47476930-47476952 CAGGGCTACCTGGATAAGGCAGG + Intronic
954297369 3:49681744-49681766 GAGGGCTGCCAGGCTGCAGCAGG - Exonic
955387999 3:58494486-58494508 AAGGGCTGCCTGGAAACTCTGGG + Intronic
957060965 3:75481057-75481079 GAAGACTGCCAGGAGACTGCAGG + Intergenic
958991500 3:100851390-100851412 GGAGGCTGCCTGTGTACTGCAGG + Intronic
961522777 3:127476840-127476862 GAGGGCTCCTTGGATCCAGCAGG + Intergenic
961623188 3:128240544-128240566 GAGGACAGGCTGGACACTGCTGG + Intronic
961958064 3:130824748-130824770 GAGGGCTGCCCTCAGACTGCTGG + Intergenic
962600076 3:136984900-136984922 GAATGCTGCCTGGGCACTGCAGG - Intronic
963138326 3:141928093-141928115 GAAGGATGCCTGGACACAGCTGG + Intergenic
966207132 3:177416498-177416520 GAGGTCTGCCTAGAAACTTCTGG - Intergenic
967734270 3:192935655-192935677 GAGGACTCCTTGGATCCTGCAGG + Intergenic
967967380 3:194972725-194972747 GAGTGCTTCCTGGTTAGTGCTGG + Intergenic
968506873 4:974772-974794 GAGGGCTGCCTGGGGGCAGCAGG + Intronic
968894637 4:3391810-3391832 GAGGGCTGCCTGGGTGCTCCAGG + Intronic
969697263 4:8741867-8741889 CAGGGCTGCCTGGCTAGGGCAGG - Intergenic
969890351 4:10254506-10254528 AGGGCCTGCCTGGCTACTGCAGG + Intergenic
970138292 4:12950802-12950824 GATGGCTGCCTGGATAGTATGGG - Intergenic
970771203 4:19614889-19614911 GGGAGCTGCCTGGAGACTGTGGG + Intergenic
971938975 4:33189434-33189456 GAGGGCTGCCAGGATGGGGCTGG - Intergenic
974115886 4:57578714-57578736 GAGGGCCCCCTGGAAGCTGCTGG - Intergenic
974235294 4:59173169-59173191 GAAGGCTGTCTGCATACTGCAGG - Intergenic
975343617 4:73269161-73269183 TAGGTCTGCCTGCATAATGCAGG + Intergenic
975403726 4:73965891-73965913 GAGGGCTGACTAGATGCAGCTGG - Intergenic
977415132 4:96722868-96722890 GTGGGCTGTCTGTATACTACTGG - Intergenic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
979346155 4:119589852-119589874 GAGATCTGCCTGTATTCTGCTGG - Intronic
982073286 4:151714425-151714447 GAGGTCTGCCTGGAGTCTGCAGG - Intronic
983058728 4:163129993-163130015 AAGGGGTGCCTTGTTACTGCTGG - Intronic
983762709 4:171432127-171432149 GAGGGGAGCCTGTTTACTGCTGG - Intergenic
984703368 4:182832611-182832633 AAGAACTGCCTGGATACTGCTGG - Intergenic
985492542 5:187987-188009 CAGGGATGCCTGGATCCTGGGGG - Exonic
985570574 5:642644-642666 CAGGGCTGCCTGCAAACTGCAGG - Intronic
986350016 5:6868509-6868531 GCGGGCTGCCTGGTTGATGCAGG - Intergenic
986395238 5:7322646-7322668 GGGGGCTGCCTGTGTATTGCAGG - Intergenic
986697856 5:10374474-10374496 GTGGGCTGCCTGGATACTGCTGG + Intronic
988265331 5:28942014-28942036 GAGTCCTGCCTGGCTACTGCTGG + Intergenic
988663021 5:33293832-33293854 GAGTGCTACCTTGTTACTGCTGG - Intergenic
989657731 5:43762226-43762248 GAGTACTGCCTGCCTACTGCTGG + Intergenic
995410038 5:111846590-111846612 GAGGGCTGCCTGGATACTGCTGG + Intronic
997047380 5:130334433-130334455 GATGGCTGATTGGATATTGCAGG - Intergenic
998157110 5:139793345-139793367 GAGGGCTGCCTGGAGGCCACAGG - Intergenic
1001449813 5:171815955-171815977 GAGGTCTGCCTGGTTATTTCTGG - Intergenic
1001579383 5:172788633-172788655 GTGTGCAGCCTGGACACTGCAGG + Intergenic
1003040139 6:2680483-2680505 GAGGACAGGCTGGATAATGCAGG - Intronic
1003085969 6:3061818-3061840 GAGGTATGCCTGTATATTGCTGG + Intergenic
1006299162 6:33184776-33184798 GAAGGAGGCCTGGATACTGAAGG + Intronic
1006373094 6:33657404-33657426 GAGGGCTGCCTGGAGGCAGTGGG + Intronic
1006714682 6:36109154-36109176 GAAGGCTGCCTGATTACTCCGGG - Exonic
1007500846 6:42295600-42295622 GAGGGCTTCCTGGATGAGGCTGG - Intronic
1007587887 6:43003002-43003024 GGGGGCTGCCTGGACAGTCCAGG + Intronic
1009816529 6:68743883-68743905 GAGGACTGCTTAGAAACTGCTGG + Intronic
1011753339 6:90475061-90475083 CAGGCCTGCCTGGATAATCCAGG + Intergenic
1013904761 6:115202281-115202303 GAGAGGTGCCTTGTTACTGCTGG + Intergenic
1014214966 6:118744635-118744657 GAGGGCAGCCTGCACAGTGCGGG - Intergenic
1016362025 6:143277633-143277655 GAGGCCTGCCTGTATCCTACAGG + Intronic
1016986816 6:149901367-149901389 CAGGGCTGCCTTGAATCTGCAGG + Intergenic
1018952400 6:168387662-168387684 GAGGGACGCCTGCATCCTGCCGG - Intergenic
1020106387 7:5424056-5424078 GAGGGGAGCCTGGAAACTGCTGG - Intronic
1020570307 7:9851702-9851724 GAGAGGTGCCTAGTTACTGCTGG + Intergenic
1021219499 7:17959947-17959969 GAGGCCAGCCTGGAAAATGCAGG + Intergenic
1021555062 7:21910782-21910804 CAGGCCTGCCTGGATTCTGGAGG - Intronic
1022814520 7:33902062-33902084 AAGGGCAGCCTGGACACAGCAGG - Intergenic
1023019845 7:36001536-36001558 TGGGGCTGCCTGGATAATCCAGG - Intergenic
1026843465 7:73683807-73683829 GAGGGGAGCCTGAATACTGCGGG + Intronic
1027685308 7:81273478-81273500 GAGTACTGCCAGGTTACTGCTGG + Intergenic
1029034599 7:97505706-97505728 GAGGCCTGCCAGGAAACAGCAGG - Intergenic
1029134900 7:98362986-98363008 CAGGCCTGCCTGGAAACTTCTGG + Intronic
1030685137 7:112478634-112478656 TAGGCCTGCCTGAATTCTGCAGG + Intronic
1034699026 7:153080781-153080803 GAGGTGTGCCTGGCTCCTGCAGG + Intergenic
1035740228 8:1922147-1922169 GAGGGCTTCCTGTGTACTACAGG - Intronic
1040014748 8:42691281-42691303 GAGGGCTGCCATCAAACTGCTGG - Intergenic
1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG + Intronic
1044712027 8:95067595-95067617 GAGGGGCTCCTGGTTACTGCTGG + Intronic
1047456453 8:125017416-125017438 GAGTACTGCCTGGCTGCTGCTGG + Intronic
1047571058 8:126099093-126099115 GAGGGCTCCAAGGAGACTGCTGG + Intergenic
1048029921 8:130621431-130621453 GGGTACTGCCTGGCTACTGCTGG + Intergenic
1048062571 8:130935625-130935647 GAGTGCTGTCTGTAAACTGCAGG - Intronic
1048843521 8:138585166-138585188 AAGGGCTGCCTAGAAAGTGCTGG + Intergenic
1049011408 8:139890068-139890090 GAGGGGTGCCTCGCTGCTGCTGG - Intronic
1051278725 9:15420973-15420995 GAGGGCTGACTGTATACTACTGG + Intergenic
1054735374 9:68745070-68745092 GAGAGCTGGCTGGATGCTGACGG - Intronic
1056765339 9:89441587-89441609 GAGGGCAGCCTGGAAGCAGCAGG + Intronic
1059117201 9:111610273-111610295 GAGCTCTGCCTGGACACTTCTGG + Intergenic
1060530802 9:124346189-124346211 GAGTGCAGCCTGGAGACTGTGGG - Intronic
1060876062 9:127084433-127084455 GAGGGCTGCCTGGATGGTGGGGG - Intronic
1061659939 9:132122850-132122872 GAGGGCACCCTGAAGACTGCGGG - Intergenic
1061728560 9:132595587-132595609 GAGGGCTGCGTGGAACTTGCTGG - Intronic
1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG + Intergenic
1061953545 9:133949746-133949768 CAGGGCTGCCTGCGTGCTGCAGG - Intronic
1062174143 9:135151645-135151667 GAGGGCGGCCTGGAGGCTGGGGG - Intergenic
1062220288 9:135411303-135411325 GAGGGTTTCCTGGATCGTGCCGG - Intergenic
1062274534 9:135724443-135724465 CTGGCCTGCCTGGATCCTGCAGG - Intronic
1062355577 9:136160492-136160514 TGGGGCTGCCTGGTCACTGCAGG + Intergenic
1062625054 9:137438800-137438822 GGGGGCTACTTGGATCCTGCTGG - Intronic
1186673183 X:11787928-11787950 GAGGGCTACCCGGCTGCTGCTGG - Intergenic
1187245003 X:17546093-17546115 AAGTGCTGCCTGGCTAGTGCTGG + Intronic
1190597876 X:52065191-52065213 GAGGGCTGCCTGGTGACTGCTGG - Intronic
1190610948 X:52188882-52188904 GAGGGCTGCCTGGTGACTGCTGG + Intronic
1199036138 X:143053064-143053086 GAGTGCTGCCAGACTACTGCTGG + Intergenic
1200147113 X:153932100-153932122 CAGGGCGGCCCGGTTACTGCAGG + Exonic
1200918031 Y:8588617-8588639 GAGGCTTGCCTAGATATTGCAGG + Intergenic
1200918494 Y:8592340-8592362 GAGGGCTGCATGATTCCTGCAGG + Intergenic
1200936925 Y:8746449-8746471 GAGGGCTGCATGTTTACTGTAGG - Intergenic
1200963640 Y:9017035-9017057 GAGGGCTGCATGATTCCTGCAGG - Intergenic
1202129733 Y:21598755-21598777 GAGGGCTGCATGATTTCTGCAGG - Intergenic
1202182848 Y:22154211-22154233 GAGGGCTGCATGACTACTGTAGG - Intergenic
1202208511 Y:22432190-22432212 GAGGGCTGCATGACTACTGTAGG + Intergenic