ID: 995410151

View in Genome Browser
Species Human (GRCh38)
Location 5:111848017-111848039
Sequence GTTGAGTTTTACTGAAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995410151_995410155 -7 Left 995410151 5:111848017-111848039 CCTGAGCTTCAGTAAAACTCAAC 0: 1
1: 0
2: 0
3: 16
4: 258
Right 995410155 5:111848033-111848055 ACTCAACTGGTGGGTCCTGAAGG No data
995410151_995410156 -2 Left 995410151 5:111848017-111848039 CCTGAGCTTCAGTAAAACTCAAC 0: 1
1: 0
2: 0
3: 16
4: 258
Right 995410156 5:111848038-111848060 ACTGGTGGGTCCTGAAGGTTTGG 0: 1
1: 1
2: 2
3: 57
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995410151 Original CRISPR GTTGAGTTTTACTGAAGCTC AGG (reversed) Intronic
900107352 1:989229-989251 GTTGATTTTTTCTGGAGTTCAGG + Intergenic
906542977 1:46602440-46602462 GTTTATTTTGACTGAAGCACAGG + Intronic
908015282 1:59826240-59826262 CTTGAGTGTTATTGAAGTTCTGG + Intronic
909455186 1:75842188-75842210 GTTGAGTTTATCTGAAGACCTGG + Intronic
910437969 1:87224986-87225008 GTTGAGATCCACTGGAGCTCAGG - Intergenic
910532750 1:88258938-88258960 GTTGAGTTCTGCTGAATCACTGG - Intergenic
910675777 1:89815275-89815297 GATCAGTTTTACTGATGCTTTGG + Intronic
911081655 1:93938968-93938990 GTTGAGTTTTGCTGCAGCTGTGG + Intergenic
911193467 1:94970882-94970904 GTTGGTTTTTACTGAAGATTCGG - Intergenic
912346446 1:108967545-108967567 GTTGAGTTTGTCTGAAGACCTGG + Intergenic
913314832 1:117540925-117540947 GGTGAGTTTCGCTGGAGCTCTGG + Intergenic
915064995 1:153217598-153217620 GTTGAGTCTTGTTGAAGATCAGG + Exonic
915144022 1:153783949-153783971 GGTGAGTTTTAAAGAGGCTCTGG - Intergenic
915672457 1:157501799-157501821 GTTGAGTTTATCTGAAGACCTGG + Intergenic
915880645 1:159667594-159667616 GTTGAGTTTATCTGAAGACCTGG + Intergenic
916334438 1:163654323-163654345 TCTTAGTTTTACTGAAGCTATGG + Intergenic
917828348 1:178848378-178848400 GTTCAGTCTTACTGAAGATAAGG + Intronic
918968486 1:191381511-191381533 GTTGAGTTTATCTGAAGACCTGG - Intergenic
919455471 1:197815520-197815542 GTTTAATTTTACTGAAGATTAGG - Intergenic
919639165 1:200032624-200032646 GATGAGTTTGAGTGAAGCTAAGG + Intronic
922203010 1:223422562-223422584 GTTGAGTTTATCTGAAGACCTGG + Intergenic
924683491 1:246262225-246262247 GTGGATTGTTAGTGAAGCTCAGG + Intronic
1064029092 10:11871796-11871818 GTTGAGTATTACTTAAATTCAGG + Exonic
1065241448 10:23709055-23709077 GTTGGCTCTTTCTGAAGCTCTGG + Intronic
1065882391 10:30047817-30047839 GTTGAGCTTTGCTGAAGCCCAGG - Exonic
1067266028 10:44745981-44746003 GTTGAGTTTATCTAAAGCCCTGG + Intergenic
1068181638 10:53527293-53527315 GTTGAGTTTATCTGAAGACCGGG + Intergenic
1069185743 10:65420436-65420458 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1070255594 10:74811042-74811064 GTTGAGTTTTTCTGAAGTCCTGG + Intergenic
1071074040 10:81730236-81730258 GTTGAGTTTGTCTGAAGGCCTGG + Intergenic
1073548585 10:104375843-104375865 GTTGAGTTTATCTGAAGACCTGG + Intronic
1073867758 10:107824642-107824664 GTTGAGTTTGTCTAAAGATCTGG + Intergenic
1074215147 10:111376906-111376928 GTTGAGTTTATCTGAAGAACTGG + Intergenic
1074439180 10:113459963-113459985 GTGGAATCTTACTCAAGCTCTGG - Intergenic
1076838936 10:133035529-133035551 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1078325983 11:10381128-10381150 GTTGCTCTTGACTGAAGCTCTGG - Intronic
1079643468 11:22834636-22834658 GTTGAGTTTGTCTGAAGACCTGG - Intergenic
1081098939 11:38977870-38977892 GTTGAGTTTATCTGAAGACCTGG + Intergenic
1081932548 11:46882119-46882141 GTGGAGTTTTGCTTAAGCTGTGG - Intronic
1082689550 11:56282963-56282985 GTTGAGTTTGTCTAAAGATCTGG + Intergenic
1084217932 11:67661111-67661133 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1086760560 11:90625241-90625263 GTTGAATTTATCTGAACCTCAGG - Intergenic
1088178050 11:107076384-107076406 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1092336148 12:7635809-7635831 GTTGAGTTTATCTGAAGAGCTGG + Intergenic
1092592043 12:9961105-9961127 GTTGAGTTTATCTAAAGGTCTGG + Intronic
1092594337 12:9985112-9985134 GTTGAGTTTGTCTGAAGACCTGG + Exonic
1093475211 12:19547302-19547324 GTGGAGTTTTACCCAGGCTCAGG - Intronic
1093753435 12:22827325-22827347 GTTGAGTTTACCTGAAGACCTGG - Intergenic
1094589637 12:31808470-31808492 GTTGAGTTTATCTGAAGGCCGGG - Intergenic
1094618661 12:32059393-32059415 GTTGAGTTTATCTGAAGGCCTGG - Intergenic
1095215315 12:39540724-39540746 GTTGAGTTTTTCTAAAGACCTGG - Intergenic
1096049332 12:48593430-48593452 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1097856328 12:64467306-64467328 CTTTAGTTTTACTGATGCTATGG + Intronic
1098638677 12:72814775-72814797 GTTGAGTTTGTCTAAAGATCTGG + Intergenic
1099144656 12:79025364-79025386 GTTGAGCTTTATAGAAGCACTGG + Intronic
1100261527 12:92936586-92936608 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1106207871 13:27616255-27616277 GTTGAGTTTGTCTAAAGCCCTGG + Intronic
1107524295 13:41214551-41214573 GTTGAGGCTTGCTGAAACTCAGG + Intergenic
1108554840 13:51582870-51582892 GTTGAGTTTATCTGAAGACCTGG + Intergenic
1109102922 13:58209290-58209312 GTTGAGTTTATCTGAAGACCTGG + Intergenic
1109316408 13:60754623-60754645 GTTGATTTTTGCTTTAGCTCAGG + Intergenic
1111122469 13:83871720-83871742 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1111638643 13:90938276-90938298 GTTTTGTTTTGCTGAAACTCTGG - Intergenic
1111731010 13:92077014-92077036 GTTGAGTTTGTCTGAAGACCTGG - Intronic
1111781822 13:92737646-92737668 CTTGAGTATTACTGATACTCTGG - Intronic
1112629509 13:101145553-101145575 ATTGAGTTTCAGGGAAGCTCAGG + Intronic
1112672477 13:101656112-101656134 GTTGAGTTTGTCTGAAGACCTGG + Intronic
1113740515 13:112709600-112709622 GTTGAGTTTATCTGAAGACCTGG - Intronic
1114839510 14:26246935-26246957 GATGACTTTCACTTAAGCTCAGG - Intergenic
1116131850 14:40864803-40864825 GTTGAGTTTGTCTGAAGACCTGG - Intergenic
1116471883 14:45295144-45295166 GTTGAGTTTATCTAAAGATCTGG - Intergenic
1116540227 14:46093255-46093277 GTTAAGTTTTACTGAGGAGCTGG + Intergenic
1116562339 14:46396380-46396402 GTTGGTATTTACTGAAGCTTGGG - Intergenic
1118920026 14:70141729-70141751 GTTTAGTTTTAATGAATATCAGG + Intronic
1118987914 14:70772419-70772441 GTTCAGCTTTACTCTAGCTCAGG - Intronic
1120677454 14:87437451-87437473 GTTGAGTTTTAATTAATCTAAGG + Intergenic
1120771339 14:88383724-88383746 GTTGAGTTTATCTGAAGGCCTGG + Intergenic
1120974790 14:90239050-90239072 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1122189440 14:100028850-100028872 GTTGAGTTTTACTCAAAGTGAGG + Intronic
1122653734 14:103242799-103242821 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1124033155 15:26029702-26029724 GTTGAGTTTGTCTGAAGACCTGG + Intergenic
1126118045 15:45226755-45226777 GTTGAGTTTATCTGAAGACCTGG + Intergenic
1126124707 15:45284856-45284878 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1126266939 15:46766084-46766106 GTTGAGTTTATCTGAAGACCTGG + Intergenic
1127642939 15:60932566-60932588 CTTGAGTTTGCCTGAAGCCCTGG + Intronic
1128469541 15:67940667-67940689 GTTGAGTTTATCTGAAGATCTGG - Intergenic
1128868035 15:71130412-71130434 GTTGAGAATTACTTGAGCTCAGG - Intronic
1129195532 15:73963461-73963483 GTTGAGTTTGTCTGAAGATCTGG - Intergenic
1130861611 15:87895898-87895920 GTTGAATTTATCTGAAGATCTGG - Intronic
1131607196 15:93919078-93919100 GTTGAGTTTGTCTGAAGACCTGG - Intergenic
1131871705 15:96770670-96770692 GTTGAGTTTGTCTGAAGACCTGG - Intergenic
1134051993 16:11143809-11143831 GTTGAGGTTTTCTGAGGCTCAGG + Intronic
1135776242 16:25259075-25259097 GTTGAGTTTGTCTGAAGACCTGG + Intergenic
1137884478 16:52087815-52087837 GTTGAGTTTATCTGAAGATCTGG - Intergenic
1141053771 16:80797183-80797205 GTTGTGTGTGCCTGAAGCTCAGG - Intronic
1143420520 17:6788033-6788055 GTTGAGTTTATCTGAAGACCTGG + Intronic
1147866123 17:43553631-43553653 GTAGGGTTTTCCTGAAACTCAGG + Intronic
1149136102 17:53366454-53366476 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1149542785 17:57480443-57480465 GTTGACATTAACTGAAGTTCAGG + Intronic
1150659811 17:67065434-67065456 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1152045963 17:77935841-77935863 GTTGAGTTTATCTGAAGACCTGG + Intergenic
1155146204 18:23085791-23085813 GTTGAGTTTATCTGAAGACCTGG + Intergenic
1157428747 18:47605869-47605891 GTTGAGTTTATCTGAAGACCTGG + Intergenic
1157909763 18:51604699-51604721 GTTGAGTTTGTCTAAAGATCTGG + Intergenic
1158750107 18:60248889-60248911 ATAAAGTTTTACTGAAGCACAGG - Intergenic
1159353739 18:67308898-67308920 GGTGAGTTTTATTGTAGCACAGG + Intergenic
1160291262 18:77596097-77596119 GTTGGGTTTGTCTGCAGCTCTGG - Intergenic
1167973450 19:53204348-53204370 GTTTATTTCTACTTAAGCTCTGG - Intergenic
925800238 2:7591826-7591848 GTTGAGTTTATCTGAAGACCTGG + Intergenic
925814054 2:7729864-7729886 GTTGAGGTTTACTAAAGTTAAGG + Intergenic
926239278 2:11072571-11072593 TTTGAGTTATAATGAAACTCTGG - Intergenic
926262785 2:11282748-11282770 TTTGAATTTTAGTGAAGTTCAGG - Intronic
926483621 2:13428751-13428773 CTTAAATTTCACTGAAGCTCAGG - Intergenic
929098281 2:38284964-38284986 GTTGAGTTTATCTGAAGACCTGG + Intergenic
929384433 2:41387627-41387649 GGTGAGTTTTACTGAATTTAAGG + Intergenic
933066716 2:77807464-77807486 GTTGAGTTTATCTGAAGACCTGG - Intergenic
935757012 2:106284080-106284102 GTAGTCTTTTACTGAAGCTGGGG - Intergenic
935889620 2:107662180-107662202 GTTGAGTTTGTCTGAAGACCTGG + Intergenic
937644352 2:124249503-124249525 GTTGAGTTTATCTGAAGTCCTGG - Intronic
937950081 2:127378607-127378629 GTTGAGTTTTTCTAAAATTCAGG - Intronic
938060645 2:128251884-128251906 GTTGAGTTTGTCTGAAGACCTGG + Intronic
938185312 2:129226557-129226579 GCTGAGTTTCCCTGAAGCTCAGG + Intergenic
941167030 2:162093565-162093587 ATAGTGTTTTGCTGAAGCTCAGG - Intergenic
942599234 2:177623237-177623259 TTAGAGTTTAACTAAAGCTCTGG - Exonic
942940245 2:181607145-181607167 GTGGAGTTTTCCAGAAGCTATGG - Intronic
946794986 2:223340956-223340978 GTAGACCTTTACTGAAGATCTGG + Intergenic
947171821 2:227320252-227320274 GTTGAGTTTATCTGAAGACCTGG + Intergenic
948020098 2:234724944-234724966 GTTGAGTTTATCTGAAGACCTGG + Intergenic
949030068 2:241790937-241790959 GTTGAGTTTATCTGAAGACCTGG - Intronic
1169241675 20:3986579-3986601 TTTGAGTTCTACTGAATCTAAGG - Intronic
1170874060 20:20234404-20234426 GTTGCCTTTTACTGAAACTTTGG + Intronic
1176095378 20:63341253-63341275 GTTGAGTTTGTCTGAAGACCTGG - Intergenic
1177037905 21:16067724-16067746 GTTGAGTTTTACTATAGATAAGG - Intergenic
1177435570 21:21048249-21048271 GTTGAGTTTATCTGAAGACCTGG - Intronic
1179619403 21:42602932-42602954 GTTGAGTTTATCTGAAGACCTGG + Intergenic
1182874860 22:33682839-33682861 GTTTTATTTTACTGAGGCTCAGG + Intronic
1184283456 22:43452384-43452406 ATTGAGTTTTACAGAACCACAGG - Intronic
1184848648 22:47104829-47104851 GTTGAGTTTGTCTAAAGATCTGG - Intronic
949118412 3:356740-356762 GGTGAGTGTGACTGAAGCTGAGG + Intronic
949439977 3:4070085-4070107 GTTGAGTTTATCTGAAGACCTGG - Intronic
949462214 3:4305041-4305063 GTTGAGTTTGTCTGAAGACCTGG + Intronic
951300113 3:20986342-20986364 GTTGAGTTTATCTGAAGACCTGG + Intergenic
953427386 3:42805971-42805993 GTTGAGTTTGTCTGAAGACCTGG + Intronic
954961689 3:54571147-54571169 GTTGAGTTTTTCTAAAGAGCTGG + Intronic
955390254 3:58517378-58517400 GAAGGGTTTTACAGAAGCTCTGG - Exonic
955550666 3:60081458-60081480 GTTGAGTTTTAAGGAACTTCAGG - Intronic
955612996 3:60777399-60777421 GTTGAGTTTATCTGAAGACCTGG + Intronic
957299707 3:78376055-78376077 GTTGAGTTTATCTAAAGATCTGG + Intergenic
959795007 3:110415929-110415951 GTTGAGTTTTAATGAAGGCCTGG - Intergenic
960599076 3:119437430-119437452 GCTGAGTTTTACTGAAACCTTGG + Intronic
961496489 3:127296052-127296074 GCTGAGGTCTACTTAAGCTCTGG + Intergenic
963353584 3:144182157-144182179 GTTGAGTTTATCTGAAGACCTGG - Intergenic
963433201 3:145235716-145235738 GTTGAGTTTGTCTAAAGATCTGG - Intergenic
964115304 3:153131000-153131022 TTTTAGTTTTACTCGAGCTCTGG + Intergenic
964394549 3:156231737-156231759 GTTGAGTTTATCTGAAGACCTGG - Intronic
965556568 3:170024654-170024676 GTTGAGTTTATCTGAAGACCTGG - Intergenic
967636334 3:191806382-191806404 GTTGAGCTTATCTGAAGATCTGG - Intergenic
967755409 3:193162943-193162965 GTTGAGTTTATCTGAAGACCTGG - Intergenic
967939997 3:194758297-194758319 GTTGCGTATGTCTGAAGCTCGGG - Intergenic
969653356 4:8481168-8481190 GTTGAGTTTGTCTGAAGACCTGG - Intronic
971333292 4:25700175-25700197 GTTGAGTTTATCTGAAGACCTGG - Intergenic
971822495 4:31576251-31576273 GTTTACTTTTAATGAAGGTCTGG + Intergenic
972166643 4:36293530-36293552 GTAAACTTTTACTGAAGCACAGG - Exonic
975250935 4:72176957-72176979 GTTGAGTTTATCTGAAGACCTGG - Intergenic
976011240 4:80492065-80492087 GTTGAGTTTGTCTAAAGATCTGG - Intronic
977903368 4:102448389-102448411 TGTGAGATTTACTGAATCTCAGG - Intergenic
978337412 4:107684644-107684666 GTTGAGTTTGTCTGAAGAACTGG - Intronic
981314438 4:143328135-143328157 GTTGAGTTTACCTGAAGACCTGG + Intergenic
981898083 4:149828317-149828339 GAGGAGTTTTACTGAAGCTGAGG - Intergenic
982793439 4:159618310-159618332 GTTGAGTTTATCTAAAGATCTGG + Intergenic
983333508 4:166361361-166361383 CTTTATTTTTACTGAAGCTTAGG + Intergenic
983620079 4:169751762-169751784 GTTCAGCTTAACTGAAGCTTAGG + Intronic
983822775 4:172216981-172217003 GTTGAGTTTGTCTAAAGATCTGG + Intronic
984364507 4:178781259-178781281 GTTGAGTTTGTCTAAAGATCTGG + Intergenic
984741432 4:183167717-183167739 GTTTAGTTTGACTGTAGCTTTGG + Intronic
985722927 5:1500094-1500116 GTAAAGTTTTACTGGAGCACGGG - Intronic
989541636 5:42625700-42625722 GTTGAGTTTGTCTGAAGACCTGG + Intronic
990006912 5:50954669-50954691 GTTGAGTTTATCTGAAGACCTGG - Intergenic
991082940 5:62620628-62620650 GTTGAGTTTTTCTAAAGACCTGG + Intronic
992453469 5:76894222-76894244 GTTGAGTTTGTCTGAAGACCTGG - Intronic
992720839 5:79559914-79559936 GTTGAGTTTATCTGAAGACCTGG - Intergenic
992930081 5:81634277-81634299 GTTGAGTTTATCTGAAGACCTGG - Intronic
992947043 5:81821345-81821367 TTTGAGTTTTAAGGCAGCTCTGG + Intergenic
994041415 5:95263821-95263843 GTTAAGACTTACTCAAGCTCTGG + Intronic
995410151 5:111848017-111848039 GTTGAGTTTTACTGAAGCTCAGG - Intronic
995663294 5:114510522-114510544 GTTGAGTTTATCTGAAGACCTGG - Intergenic
996964755 5:129294647-129294669 GTTGAGTTTACCTGAAGACCTGG + Intergenic
998066715 5:139165236-139165258 GTTGAGTTTATCTGAAGATCTGG - Intronic
998566458 5:143220265-143220287 TTTGATTTTTCCTGAAGCTTAGG + Intronic
999033047 5:148315761-148315783 TTTCAGTTTTACTGATGTTCTGG + Exonic
1000642275 5:163717124-163717146 GTTGTGTTTTACTGAAGACATGG + Intergenic
1001116034 5:168940869-168940891 GCTGTGTTTAAGTGAAGCTCTGG + Intronic
1003936476 6:10979676-10979698 GTCATGTTTTACTGAAGGTCAGG + Intergenic
1005684097 6:28235314-28235336 GTTGAGTTTATCTGAAGACCTGG + Intergenic
1005888952 6:30120656-30120678 GTTGAGTTTATCTGAAGACCTGG + Intergenic
1006344499 6:33469227-33469249 GTTGAGATTTTCTCGAGCTCAGG - Intergenic
1008883840 6:56410581-56410603 GCTCAGTTCTTCTGAAGCTCAGG + Intergenic
1009292562 6:61902349-61902371 TTTGACTTTGACTGAATCTCTGG - Intronic
1009908150 6:69893885-69893907 GTTGAGTTTATCTGAAGACCTGG - Intronic
1010383266 6:75248430-75248452 ATTGAGTTTATCTGAAGATCTGG - Intronic
1011291251 6:85779561-85779583 GTTGAGGCTTGCTGAAACTCAGG + Intergenic
1014158074 6:118135196-118135218 TTTGAGTTTTAATGACCCTCTGG - Intronic
1014949740 6:127541038-127541060 GTTGATTCTTGCTGAATCTCAGG - Intronic
1015052197 6:128854913-128854935 ATTGAGTTTTAGTGAAACTGAGG + Intergenic
1016159490 6:140860059-140860081 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1017845623 6:158255509-158255531 GCTGAGTTTTCCAGAACCTCTGG - Intronic
1017863474 6:158421472-158421494 GTTGAGTTTGTCTGAAGACCCGG + Intronic
1018814206 6:167318635-167318657 GTTGAGCTTGACGGAAGGTCTGG + Intergenic
1019099728 6:169619652-169619674 GTTGAGTTTCTCTGAAGACCTGG + Intronic
1028215658 7:88129344-88129366 GCTGAATTTTACTTAAGTTCAGG + Intronic
1033246084 7:139717354-139717376 GTTGCTTTCTACTGAAACTCAGG + Intronic
1033412371 7:141129901-141129923 GTTGAGTTTTTCTAAAGACCTGG + Intronic
1033621792 7:143068572-143068594 GTTGAGTTTGCCTGAATCTCAGG - Intergenic
1033627756 7:143127706-143127728 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1033824050 7:145168060-145168082 GGTGAGTTTTGCTAAAGCTTTGG + Intergenic
1033935400 7:146578419-146578441 GTTGTGTTTTTCTGGAGCTGAGG - Intronic
1033973995 7:147076980-147077002 GTTGTGTTTTAAAGAAACTCAGG - Intronic
1034060091 7:148079383-148079405 GTTGAGTTTATCTAAAGATCTGG + Intronic
1034683793 7:152952070-152952092 GTTGACTTTTACAGAATCTCTGG + Intergenic
1035346293 7:158201737-158201759 GTTGAGTTTATCTGAAGACCTGG - Intronic
1040664618 8:49618280-49618302 GTTGAGTTTATCTGAAGATCTGG - Intergenic
1041960517 8:63610071-63610093 GTTGAGTTTGGGTAAAGCTCTGG + Intergenic
1044000814 8:86878870-86878892 CCTCAGTTTTACTGAAGATCAGG + Intronic
1044013315 8:87020970-87020992 GTTGAGGTTGTCTGAAGATCTGG - Intronic
1044019171 8:87083468-87083490 GTTGAGTTTGTCTGAAGACCTGG - Intronic
1044645588 8:94439741-94439763 GTTGAGTTTATCTGAAGACCTGG + Intronic
1045167579 8:99624170-99624192 TTTGATTTTTTCTGATGCTCTGG + Intronic
1046054930 8:109067843-109067865 TTTCAATTTTAATGAAGCTCAGG + Intergenic
1046215929 8:111147027-111147049 ATTGAGTGTCACTGAAGCTTAGG + Intergenic
1046877582 8:119273173-119273195 GTTTAATTTTAATGAAGCCCAGG - Intergenic
1049964362 9:765144-765166 GTTGAGTTTGTCTGAAGACCTGG - Intergenic
1052074209 9:24120611-24120633 CTGAAGTTTTATTGAAGCTCTGG + Intergenic
1052121950 9:24729183-24729205 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1052541313 9:29815530-29815552 GTTAAGTTTTATTAATGCTCTGG - Intergenic
1052778329 9:32755391-32755413 GTCGAGTGTTTCTGAAGCTGAGG + Intergenic
1053241025 9:36495763-36495785 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1056085988 9:83149653-83149675 GTTGAGATTTTTTAAAGCTCGGG - Intergenic
1056642181 9:88380991-88381013 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1057348800 9:94277180-94277202 GTTGAGTTTATCTGAAGACCTGG + Intronic
1057349308 9:94281791-94281813 GTTGAGTTTGTCTGAAGACCTGG + Intronic
1061388292 9:130303228-130303250 GTTGAGTTTTCCAGGAGCTGAGG - Intronic
1061471528 9:130830413-130830435 TTTGTGTTTTGCTGAAGCTGTGG + Intronic
1061742670 9:132718502-132718524 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1185712272 X:2313956-2313978 GTTGAGTTTATCTGAAGACCTGG + Intronic
1185899485 X:3882732-3882754 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1187354718 X:18556971-18556993 GTAGGGTTTTACTTATGCTCAGG + Intronic
1188439629 X:30202633-30202655 GTTGAGTTTATCTGAAGGCCTGG - Intergenic
1188663222 X:32786992-32787014 GTTGAGTTTTTCTGAGAGTCTGG + Intronic
1188841446 X:35022786-35022808 GTTGAGTTTGTCTGAAGACCTGG + Intergenic
1188876006 X:35430983-35431005 GTTGAGTTTATCTGAAGACCTGG + Intergenic
1190339217 X:49283104-49283126 GTTGATATTTACTGAAGCTGGGG - Intronic
1190569798 X:51769615-51769637 GTTGAGTTTATCTAAAGATCTGG - Intergenic
1191130481 X:57002984-57003006 CTTGTGTTTTACTGATGCCCAGG - Intergenic
1191638240 X:63401389-63401411 GTTGAGTTTTTCTGAAGACCTGG - Intergenic
1193818479 X:86131748-86131770 GTAGTGTTTTACTGATTCTCTGG + Intergenic
1194138855 X:90182375-90182397 GTTGAGTTTATCTGAAGAACTGG - Intergenic
1194205916 X:91010867-91010889 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1194289233 X:92048986-92049008 GTTGAGTTTATCTGAAGACCTGG + Intronic
1194480091 X:94411312-94411334 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1196264662 X:113628246-113628268 GTTGAGATTATTTGAAGCTCTGG + Intergenic
1197527263 X:127578097-127578119 CTAGAGTGTTACAGAAGCTCTGG - Intergenic
1197550008 X:127879561-127879583 GTAGTGCTGTACTGAAGCTCTGG - Intergenic
1198258484 X:134945810-134945832 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1198820419 X:140641484-140641506 GTTGAGTTGTTCTGAACCTTTGG + Intergenic
1199171475 X:144739214-144739236 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1199279243 X:145980778-145980800 GTTGAGTTTGTCTAAAGGTCCGG - Intergenic
1199336776 X:146627841-146627863 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1199550308 X:149054566-149054588 CTTCCGTTTTACTGAAGTTCTGG - Intergenic
1200293478 X:154894031-154894053 GTTGAGTTTGTCTGAAGACCTGG - Intronic
1200361876 X:155615582-155615604 GTTGAATTTGGCTGAAGCTTTGG + Intronic
1200484658 Y:3752608-3752630 GTTGAGTTTATCTGAAGAACTGG - Intergenic
1200551672 Y:4585675-4585697 GTTGAGTTTATCTGAAGACCTGG - Intergenic
1200606750 Y:5273560-5273582 GTTGAGTTTATCTGAAGACCTGG + Intronic
1201601149 Y:15729926-15729948 GTTGAGTTTATCTGAAGAGCTGG + Intergenic
1202037596 Y:20650224-20650246 GTTGTCTTTTTCAGAAGCTCTGG - Intergenic