ID: 995410955

View in Genome Browser
Species Human (GRCh38)
Location 5:111856493-111856515
Sequence CTGTGTTCGAAGCAGTATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995410955 Original CRISPR CTGTGTTCGAAGCAGTATGA TGG Intronic
901429392 1:9203710-9203732 CTGTGTCCCAAGCAGGATGCGGG - Intergenic
901627277 1:10631409-10631431 CTGTGTTCCCAGCATTAAGAAGG - Intergenic
902070464 1:13730702-13730724 TTGTGTTTAAAGCAGTATGGTGG + Intronic
903334373 1:22615103-22615125 CTCTGTGCCAAGCACTATGATGG - Intergenic
905131447 1:35762276-35762298 CTATGTACAAAGCAATATGATGG + Intronic
906561468 1:46761138-46761160 CTGAGTTGGAGGCAGTATCAAGG + Intronic
907629526 1:56066358-56066380 CTGTTTTTGAAGCAGGATGGAGG + Intergenic
907661744 1:56399671-56399693 CTGTGTTCTAGTCAGTATGCTGG - Intergenic
908228159 1:62077107-62077129 CTGTATTCCAAGCAGTGAGAAGG + Intronic
912059117 1:105642136-105642158 TTGTGTTCGTACCAGTTTGATGG - Intergenic
915745544 1:158154226-158154248 GTGTGTTGGAAGCAGTGTGCAGG + Intergenic
917199772 1:172501976-172501998 CTGTATTCAAAGCAATATGCTGG - Intergenic
918264479 1:182828533-182828555 CTGTGTTTGAAGCAGGAAGAGGG + Intronic
918479166 1:184959064-184959086 CTGTGTGCGAACCAGAATTAAGG + Intronic
918806229 1:189049261-189049283 CTGTTTTTGTACCAGTATGATGG + Intergenic
920326740 1:205170835-205170857 CTGTGCTCCAAGCAGGAAGAAGG - Intronic
921952976 1:220951984-220952006 CTGAGTTAGAAGAAGTAAGAAGG + Intergenic
922187870 1:223292486-223292508 CTGTGTTTGAAGCATTTTAATGG - Exonic
1068807485 10:61214926-61214948 CTGTTTTCTAAGCTGTATCATGG - Intergenic
1071708431 10:88025005-88025027 CTGTGTGTAAAGCAGGATGAAGG + Intergenic
1072776888 10:98206379-98206401 CTGTGCTGAAAGCAATATGAAGG - Intronic
1072880603 10:99223646-99223668 GTCTGTTCCATGCAGTATGATGG + Intronic
1074480944 10:113820136-113820158 CTGTGTTCCAAACAGCAAGACGG + Intergenic
1074737617 10:116452665-116452687 CTGTGTTCTAAGCTGTATCTGGG - Intronic
1079108175 11:17587623-17587645 CTGTGTTAGAAGCAGGGTCACGG + Intronic
1079827377 11:25214084-25214106 ATTTCTTCGTAGCAGTATGAGGG + Intergenic
1085726692 11:78960932-78960954 CTGTGTTCCAGGCACTGTGATGG + Intronic
1092321977 12:7486002-7486024 ATGTATACAAAGCAGTATGAGGG + Intronic
1096953774 12:55504594-55504616 CTGTGATTGGGGCAGTATGAGGG - Intergenic
1098406608 12:70133074-70133096 CTCTGTAGAAAGCAGTATGAAGG - Intergenic
1102187552 12:110961009-110961031 CTGTGTTCCAGGCAGAAGGAAGG + Intergenic
1102419879 12:112795049-112795071 CTGTGTACGGAGCAATAAGAAGG - Intronic
1105470639 13:20691686-20691708 ATGTTTTGGAAGCAGTATAAAGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1109665241 13:65526385-65526407 CTGGGTCTGAAGCAGTGTGAGGG - Intergenic
1113510567 13:110851069-110851091 CTGAGTTCCAAGCAGTCTCAAGG - Intergenic
1114902236 14:27077615-27077637 CTGTGTTGGAAGCAGAAAGCAGG + Intergenic
1115384486 14:32779935-32779957 CTCTGTGGGAAGCAGTATGGAGG + Intronic
1115445427 14:33484269-33484291 CTATGTAGGAAGCACTATGAGGG + Intronic
1119588990 14:75867417-75867439 CTGTGTTCCAAGCACTATTCAGG + Intronic
1124577386 15:30921869-30921891 CTGTGTTCCCAGAAGTATGTGGG + Intronic
1132015522 15:98313073-98313095 CTGTGGCCAAAGCAGCATGAAGG - Intergenic
1133003781 16:2865948-2865970 ATGTGTTCGAAGCCATGTGATGG - Intergenic
1138003947 16:53313021-53313043 CTATGTACTATGCAGTATGATGG - Intronic
1140843403 16:78863659-78863681 CTGTGTGCGAGGCACTATGCTGG - Intronic
1142317597 16:89358034-89358056 CATTGTTCAAAGCAGTAAGAGGG - Intronic
1150964191 17:69948590-69948612 CTGTGTTGGAGCAAGTATGATGG - Intergenic
1152387686 17:79984902-79984924 CTGTGTCCGAAGCTGGAGGATGG - Intronic
1157198679 18:45640914-45640936 CTGTAGTCAAAGCAGTAAGAAGG + Intronic
1157392909 18:47317765-47317787 CTGGATTGTAAGCAGTATGAGGG - Intergenic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1157806668 18:50663425-50663447 CTGTGTTCCAAGCAGTATGCAGG - Exonic
1161242537 19:3230372-3230394 CTGTGTTCCAGGCCCTATGATGG + Intronic
1163793105 19:19319920-19319942 CTGTGTGCCAAGCAGTGTGCTGG - Intronic
927463746 2:23321744-23321766 CTGTGTTCTATGCAGCATGCTGG - Intergenic
928082163 2:28321130-28321152 GTGTGTCCGTAGCTGTATGATGG + Intronic
928641713 2:33306087-33306109 CTGTCTTCAAAGCAATAAGAAGG - Intronic
929803361 2:45123292-45123314 CTCTGTTTCAAGCAGTAGGAAGG + Intergenic
932074795 2:68652908-68652930 CTGTGTTTGAAGCATCATAAAGG + Intronic
932784026 2:74583787-74583809 CTGTGTTGGAACAAGTATGTTGG - Intronic
935524102 2:104144493-104144515 CTGTGCTTGAAGAAGTATCAAGG - Intergenic
935729564 2:106054248-106054270 ATGTGTTCGAAGCACTGTTAGGG - Intergenic
945644321 2:212470209-212470231 CTTTATTTGAAGCAGTATGAGGG - Intronic
1169163745 20:3405637-3405659 CTATGTTCAAAGAAGTATGCTGG - Intronic
1170841891 20:19930506-19930528 TTATGTTCAAATCAGTATGATGG + Intronic
1172976248 20:38908068-38908090 CTGTATAGGAAGGAGTATGAGGG + Exonic
1173629248 20:44498144-44498166 ATGTGTTCGAAGAAGAATGGAGG - Exonic
1178003684 21:28192840-28192862 CTGTGTCTGCAGCAGTGTGAGGG - Intergenic
1178235316 21:30834940-30834962 TTGTGTTCTAAGCAGTTTGGTGG - Intergenic
1182861512 22:33563389-33563411 CTGGGTGTGAAGCAGTGTGACGG - Intronic
950896844 3:16460460-16460482 GTGTGGTCCAAGGAGTATGAGGG - Intronic
953377603 3:42441849-42441871 ATGTGTTCCAAGCAGCAAGAGGG + Intergenic
955303322 3:57805532-57805554 CAGTGTTAGAAGTAGTAAGAGGG - Intronic
955683342 3:61525540-61525562 CTGTGTGCCAAGCAGCATGAGGG + Intergenic
959917785 3:111837149-111837171 CTGTGTTCTAAGCACTTTGCAGG - Intronic
962199354 3:133388876-133388898 CTCTGTTCGCAGCAGCCTGAGGG - Intronic
964949839 3:162276655-162276677 CTGTGCTCTAAGCAATGTGAGGG + Intergenic
966682872 3:182661929-182661951 CTTGGTTAGAAGCAGTTTGAAGG + Intergenic
966986751 3:185187462-185187484 CTGTGTTCCAGGCAGGAAGATGG + Intergenic
967424738 3:189313979-189314001 CTAAGTTCGGAGCAGTAGGAAGG + Intronic
967993972 3:195153027-195153049 CTCTGTGGGAAGCAGTCTGACGG + Intronic
968289501 3:197527635-197527657 CTGTGGCTGAAGCAGAATGAGGG - Intronic
970858528 4:20675799-20675821 CTGTATTTGAAGTACTATGATGG + Intergenic
972875838 4:43358766-43358788 CTATGTGCCAAGCAGTATGCTGG + Intergenic
975796644 4:78012922-78012944 CTGTGTACCAAGAAGAATGATGG - Intergenic
980155147 4:129095370-129095392 CTGTGTTCCAGGTATTATGATGG - Intronic
985063031 4:186096924-186096946 CTGTGATCGAGGCAGTCTGCAGG - Intergenic
986815784 5:11408542-11408564 CTTTCTTCAAAGCAGGATGAAGG + Intronic
987874772 5:23667378-23667400 CTGTGTTATCAGCTGTATGATGG + Intergenic
991523038 5:67522043-67522065 CTGTTTTCAAAACCGTATGAGGG + Intergenic
991948335 5:71923361-71923383 AAGTGTTGGAAGGAGTATGAAGG + Intergenic
992230682 5:74660445-74660467 CTATGTTTGAAGCAGGAAGAGGG - Intronic
992450688 5:76873167-76873189 CTGTGTGGGAGGCAGTATCATGG - Intronic
992768828 5:80028311-80028333 CTCTGTTGAAAGCAGTTTGATGG - Intronic
993359396 5:86955381-86955403 CTGTGTTTGGAGGAGAATGAGGG + Intergenic
995410955 5:111856493-111856515 CTGTGTTCGAAGCAGTATGATGG + Intronic
999008491 5:148008300-148008322 CTGTGTTCAAACCATTATGTCGG + Intergenic
999232217 5:150068393-150068415 CTGTGTTCCAGGCAGTGTGCAGG - Intronic
1001453440 5:171843328-171843350 CTGTGTTCGAGGCAGAAAGTAGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004954407 6:20712223-20712245 CTGTGCTCGGGGCAGTATGCAGG + Intronic
1005092914 6:22078066-22078088 CTGTGTTCTAAGGAGTGTTAAGG + Intergenic
1006424032 6:33952719-33952741 CTGTGTTCGAGGCAGCAGGAAGG + Intergenic
1014839494 6:126201190-126201212 CTGTTTCCGAAGCACTATCATGG - Intergenic
1019873431 7:3788716-3788738 CTGTGTTCAAAGCAGTCCGCGGG + Intronic
1020999513 7:15311113-15311135 TTGTGTTGGAAGCAGAATAACGG - Intronic
1022815783 7:33912952-33912974 CTGTGTTTGAAGCATTGTGCTGG + Intronic
1022833994 7:34096369-34096391 CTGTTTTGGGAGCAGTATCAGGG + Intronic
1024198090 7:47079830-47079852 CTGTGAGCCAAGCATTATGATGG + Intergenic
1028615819 7:92765671-92765693 CTATGTTCCAGGCAGTATGCTGG + Intronic
1029726347 7:102408165-102408187 CTGTGTTCAAAGCAAGAAGAAGG + Intronic
1041687397 8:60657103-60657125 CTGAGTTCCAACCAGTTTGATGG + Intergenic
1043549097 8:81348786-81348808 CTGTGTTCCAGGCAGAAGGAAGG + Intergenic
1045451768 8:102334049-102334071 CAGTGTTGGAAGCACAATGAAGG + Intronic
1046684526 8:117210285-117210307 CTCTGTTCCAAGCAGCAAGATGG + Intergenic
1051615871 9:19006192-19006214 CTCTGTGCAAAACAGTATGATGG + Intronic
1051698233 9:19791233-19791255 CTGTGTTCCAGGCAGGAAGAAGG + Intergenic
1053012611 9:34643255-34643277 CTCTGTTCCAAGCAGTATTTAGG - Intronic
1055496804 9:76862944-76862966 CTGTGTGCAAAGCAGTAGGCTGG - Intronic
1056985308 9:91358714-91358736 CTGTGTTAGAAACATTTTGATGG - Intronic
1059287604 9:113188562-113188584 CTGTGTTGGAAGCAGGTTTAGGG - Intronic
1059534993 9:115072231-115072253 CTGTGTTCTAGGCAGCATAAGGG - Intronic
1060387913 9:123249815-123249837 CTATTTTCCAAGTAGTATGAAGG + Intronic
1060421684 9:123473637-123473659 TTGTGTAGGAAGCAGTATGAGGG + Intronic
1187076191 X:15937685-15937707 CTGTATTCCAACCAGAATGAAGG - Intergenic
1188599393 X:31942708-31942730 CTGTGATGGAAACATTATGAGGG - Intronic
1189330552 X:40142100-40142122 CTGTGTGCAAAGCACTATGCTGG - Intronic
1194640055 X:96392915-96392937 CTGAGTATGAAGCAGTAGGAGGG + Intergenic
1194937854 X:99972536-99972558 CTGTATTCTAAGCAGAAGGACGG - Intergenic
1195849259 X:109265124-109265146 CTGTGTTCTAGGGAGTGTGAGGG - Intergenic
1196988527 X:121301661-121301683 CTATGTTCCCAGCACTATGAAGG - Intergenic