ID: 995413830

View in Genome Browser
Species Human (GRCh38)
Location 5:111887498-111887520
Sequence TGCTGAAGTCCATTTGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995413828_995413830 8 Left 995413828 5:111887467-111887489 CCATGACTCTCAGTGAGATACAA 0: 1
1: 0
2: 1
3: 15
4: 168
Right 995413830 5:111887498-111887520 TGCTGAAGTCCATTTGGAGAAGG 0: 1
1: 0
2: 1
3: 24
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995413830 Original CRISPR TGCTGAAGTCCATTTGGAGA AGG Intronic
901946997 1:12712194-12712216 TGCTGGATTCCTTTTAGAGAGGG + Intergenic
902782171 1:18711885-18711907 TGCAGAAGGCCAGTTGGGGAGGG - Intronic
902888955 1:19427549-19427571 TGCTGGGGGCGATTTGGAGAAGG + Intronic
903358700 1:22763538-22763560 TGCTGAAGGGCATTTGAAGTGGG - Intronic
903790775 1:25891575-25891597 CTCAGAAGTCCATTTTGAGAAGG - Intronic
904432681 1:30475150-30475172 TGCAGAAGTCCACTTCCAGATGG - Intergenic
905205161 1:36339249-36339271 TGCTGAACTCCATCTGGGGTAGG - Intergenic
908044730 1:60156461-60156483 TCCTGAAGTCGTTTTAGAGAGGG - Intergenic
908512334 1:64859438-64859460 TGCTGAAGTACCTCTGGTGATGG - Intronic
914342658 1:146773613-146773635 TGCTGAAGGCCATTGGCAGCCGG + Intergenic
916027012 1:160841769-160841791 TGATGAAATCCATTTTGTGAGGG + Exonic
916790072 1:168117105-168117127 TGCTGATGCCCTTGTGGAGAGGG - Intronic
916871698 1:168921698-168921720 TGGTGAGGGCAATTTGGAGATGG - Intergenic
917312259 1:173690185-173690207 TGCTGGAGTCCTTTTAGAGAGGG + Intergenic
917406785 1:174715555-174715577 GGCTGCAGTCTGTTTGGAGAAGG - Intronic
923679867 1:236110741-236110763 GGGTGAGGTCCAATTGGAGAGGG - Intergenic
923727010 1:236515228-236515250 TGCTTTAGTTTATTTGGAGATGG - Intergenic
923967790 1:239161394-239161416 TGTAGAAGTCCATTTAAAGATGG + Intergenic
924944100 1:248833996-248834018 TCCTGAAATCCATTTTGATATGG + Intergenic
1063280910 10:4628444-4628466 TCCTTAAGTCCATGTGGAGGTGG + Intergenic
1064561706 10:16600295-16600317 TGCTGAAGCCCACTTCTAGAAGG + Intronic
1065192037 10:23221355-23221377 ATCTCACGTCCATTTGGAGAAGG - Intronic
1066362163 10:34741608-34741630 TTCTGTGGTCCATTTGTAGATGG - Intronic
1070001432 10:72380860-72380882 TACTCAAGTCCTTTTGGTGAGGG + Intronic
1071964204 10:90835670-90835692 TGCTGAGGTCCTTTGGGACAGGG - Intronic
1072155727 10:92722016-92722038 TGCAGAAGTCCAATAAGAGAAGG + Intergenic
1073073743 10:100810510-100810532 TGCTGAGGGCCATTTGGTCATGG - Intronic
1073450183 10:103604510-103604532 TGCTGGGGTCCATTTGGACTGGG + Intronic
1073685216 10:105745140-105745162 TGCTGGGGCCCATTGGGAGATGG + Intergenic
1074230230 10:111526413-111526435 AGCAGAAGTGCATTTAGAGAAGG - Intergenic
1075672302 10:124270888-124270910 TGCTGGGGCTCATTTGGAGAGGG - Intergenic
1078013336 11:7591317-7591339 TGCCGAAGTCCACATGGACACGG - Intronic
1078558415 11:12350180-12350202 AGCTGAAGGTCATTTGGATAAGG + Intronic
1078593791 11:12669446-12669468 TGCAGAAGCCCAATTGGAGAGGG + Intergenic
1081885413 11:46491698-46491720 TGCAGAATGCCATTAGGAGAAGG - Intronic
1083545410 11:63545607-63545629 GGCTGAAGTACAGCTGGAGATGG + Intronic
1084453592 11:69254501-69254523 TGCAGAAGTCCAGTGGGAGGAGG + Intergenic
1086987017 11:93261678-93261700 TGTTGAAGTCCTTTTAGGGAAGG - Intergenic
1087498647 11:98922030-98922052 AGCTCAGGCCCATTTGGAGATGG + Intergenic
1088109816 11:106248278-106248300 TGCTGAATTTGATTTGTAGAGGG + Intergenic
1088111885 11:106271356-106271378 TGCTGAAGTCCATTGAGAATAGG + Intergenic
1088169533 11:106979970-106979992 TGCAGAAGTCCAGTTGGTGAGGG + Intronic
1088536639 11:110868587-110868609 TCCTGAGGTCCATTTATAGAAGG - Intergenic
1090615482 11:128510556-128510578 TGCTGAACCCCAATTGGAGGAGG + Intronic
1091685451 12:2558310-2558332 TGCTGAGGTCCATCTGGTTAGGG + Intronic
1095145191 12:38719151-38719173 TTCTGAAGTCCATTTGTAAAAGG - Intronic
1097332125 12:58342717-58342739 TGGTGAAGCCCACTTGGTGATGG + Intergenic
1097756844 12:63416191-63416213 CGCTGAAGTCCTTTTAGGGAAGG - Intergenic
1099049988 12:77770371-77770393 TGCTGAAGTAGCCTTGGAGATGG + Intergenic
1099163008 12:79268742-79268764 TTCTGAAGGCTATTTGGAGAAGG + Intronic
1100007111 12:89907886-89907908 TGCTGAATTCAATTTGGATGTGG + Intergenic
1103767728 12:123293570-123293592 TTGTGAGGTCCATTTTGAGAGGG + Exonic
1103859804 12:124003232-124003254 TACAGGATTCCATTTGGAGAAGG + Intronic
1104570180 12:129918175-129918197 TGCTGATCTCCATGTGGAGATGG + Intergenic
1107405317 13:40106895-40106917 TTCCGAAGTCCATTTGGTGATGG - Intergenic
1108339418 13:49483266-49483288 TTTTGAAGTACATTTGGAAAAGG - Intronic
1112683804 13:101799166-101799188 ACCTGAAGTCCATTTGGGAATGG + Intronic
1112796585 13:103063429-103063451 TGCTGGAGTTCAAGTGGAGATGG + Intronic
1115270994 14:31552312-31552334 TGCTGAAAGCAATATGGAGATGG - Intronic
1116107291 14:40526253-40526275 TGCTGAAGACATTTTAGAGATGG + Intergenic
1117102177 14:52361021-52361043 AGCTGAACTCCATTTGTAGAGGG + Intergenic
1117574250 14:57082268-57082290 TGAAGATGTACATTTGGAGATGG + Intergenic
1120169185 14:81232123-81232145 TGTGTAAGTCCCTTTGGAGAAGG - Intergenic
1120263853 14:82224299-82224321 TGCTTAATTCCATATTGAGAAGG - Intergenic
1120265652 14:82247465-82247487 TGCTGAAATACATTTAGAAATGG + Intergenic
1122404091 14:101489191-101489213 TCATAAAGTCCATGTGGAGATGG - Intergenic
1123821919 15:24038886-24038908 TGCTGAGGCTCAGTTGGAGAAGG + Intergenic
1125182937 15:36897927-36897949 AGCTGAAGTCCCTTTGGAGGAGG + Intronic
1129707470 15:77802922-77802944 AGCTGAAGGCCACTTGGGGATGG - Intronic
1130285751 15:82553081-82553103 TTCTGAAGTCCCTTTGGAGTTGG - Intronic
1130944945 15:88544014-88544036 TGCTTCAGTCTATCTGGAGAAGG - Intronic
1131923075 15:97351496-97351518 TGCTCAAGTCCATATGTAAAAGG - Intergenic
1133786840 16:8980499-8980521 TGCTGAAGTCCATTATCAAATGG + Intergenic
1135540282 16:23324746-23324768 TGCTGGAGGCAACTTGGAGAGGG - Intronic
1136925509 16:34369466-34369488 TTTTGAAATCAATTTGGAGATGG - Intergenic
1136979065 16:35042340-35042362 TTTTGAAATCAATTTGGAGATGG + Intergenic
1137935130 16:52627709-52627731 TGCTGAAGTCCATTAAGAAGAGG + Intergenic
1139228047 16:65252311-65252333 AGATGAAGTCAATGTGGAGAAGG - Intergenic
1139991326 16:70941715-70941737 TGCTGAAGGCCATTGGCAGCCGG - Exonic
1141551238 16:84807972-84807994 TGCTCAAGCCCATGTGGATAAGG + Intergenic
1142590330 17:1002169-1002191 TGCTGAAGCCCAACTGTAGACGG - Exonic
1144671996 17:17138142-17138164 TGCTGCAGACCATTTGGTGGGGG - Intronic
1146447048 17:32940613-32940635 TGCTCAAATAAATTTGGAGATGG - Intronic
1150288195 17:63965967-63965989 TGCGGGAGTCCATGAGGAGATGG + Intronic
1152524328 17:80878993-80879015 TGCTGAAGACCACTTTCAGAGGG - Intronic
1153503593 18:5772551-5772573 TGCTGCACTCCATCTGGAAATGG - Intergenic
1153826690 18:8881796-8881818 TGCTGGAGTCCTTTTAGAGAGGG + Intergenic
1157161180 18:45315779-45315801 TCCTGAAGTTCATTTGTAGCTGG + Intronic
1157999265 18:52597145-52597167 TCCTAAAGTCAATTTGCAGAAGG + Intronic
1158956433 18:62544253-62544275 TGATGACTTCCATTTTGAGATGG - Intronic
1162268479 19:9595347-9595369 CGCTGGAGTCCTTTTAGAGAGGG + Intergenic
1167297459 19:48660063-48660085 TCCTGAGGTCCATTTGGACCTGG - Intergenic
925383010 2:3440183-3440205 TTCTGAAGTTAATATGGAGAAGG - Intronic
929411376 2:41700450-41700472 TTCAGCAGTCCATTTGGAAAGGG - Intergenic
931460335 2:62444438-62444460 TTCTAAAGTTCATTTAGAGAAGG - Intergenic
932681153 2:73826799-73826821 TGCTGAAGCCTATTTGCTGAAGG + Intergenic
933605419 2:84377355-84377377 TGCTGAGGTCCATTTTAAAAAGG + Intergenic
935047913 2:99498421-99498443 TGCTGGAGTCCTTTTAGAAAGGG - Intergenic
936611928 2:114010072-114010094 TGCTGATGCCCATCTGGAGAGGG - Intergenic
938617514 2:133014418-133014440 AGCAGGAATCCATTTGGAGATGG - Intronic
938626113 2:133111301-133111323 TGGTGAGGTCCTTTTTGAGATGG - Intronic
941201312 2:162513699-162513721 TATTGAAGTACATTTGGAGGAGG - Intronic
944936063 2:204569750-204569772 TGATGAAAACCAGTTGGAGAAGG + Intronic
944979520 2:205099672-205099694 TGCTGAAGTCAATTTGAAATTGG + Intronic
944992318 2:205252454-205252476 TGCTTAATTCCATTTGGAATTGG + Intronic
948686128 2:239670781-239670803 TGATGCAGTCCAGTGGGAGATGG + Intergenic
1169456739 20:5758732-5758754 TAAGGAAGTCCATTTTGAGATGG + Intronic
1171168497 20:22994372-22994394 TGCAGAAGTGCACTTGAAGATGG + Intergenic
1171415346 20:24975673-24975695 TCCTAAAGTTCATATGGAGAGGG + Intronic
1172276904 20:33685029-33685051 GGCTGAATTCCAGTGGGAGAAGG - Intronic
1173184709 20:40831626-40831648 TGCTGTAGTCGCATTGGAGATGG + Intergenic
1173422496 20:42914988-42915010 TGAAGTAGGCCATTTGGAGAGGG - Intronic
1177903237 21:26943411-26943433 GGCTGAAGTGCATTTGGACCAGG + Exonic
1182805574 22:33067172-33067194 CTCTGAAGTCCAGATGGAGATGG - Intergenic
1182810578 22:33112753-33112775 GGCTGGAGTCCTTTTGAAGAGGG + Intergenic
1184877278 22:47283764-47283786 TGCTCAGGAGCATTTGGAGAGGG - Intergenic
949117405 3:343925-343947 TGCTAAAGTCCCTTTGAAGATGG + Intronic
949752162 3:7366163-7366185 TGTTAAAGTCCTTTTGGGGATGG - Intronic
949837520 3:8285458-8285480 TGCTGAGGTCCACTTAGACATGG + Intergenic
950846750 3:16022616-16022638 CGCTGGAGTCCTTTTAGAGAGGG + Intergenic
950895801 3:16449821-16449843 TGCTGAAGTACTTGTGGAAAGGG + Intronic
951331439 3:21373910-21373932 TTCTGAAGGCAATTTGGAGCAGG + Intergenic
952433428 3:33248049-33248071 TGCAGAAATGCATGTGGAGAAGG + Intergenic
952818717 3:37467701-37467723 TGCTGATGTAAATTTGGAGTTGG + Intronic
953584936 3:44191074-44191096 TTCTGAAGTCCATTAAGTGAAGG + Intergenic
954231046 3:49217950-49217972 TGCTGAAGTCCAAGGGGAGTGGG + Intronic
954899590 3:54007392-54007414 TGTTAGAGTCCATTGGGAGAAGG + Intergenic
958878267 3:99639796-99639818 TGCTCAAGACCACTTAGAGAAGG + Intronic
961582241 3:127892298-127892320 TGCTGGAGTCCTTTTAGAGAGGG - Intergenic
962269891 3:133969821-133969843 TGTTAAAGTCCATATGGAGTGGG + Intronic
963042839 3:141081961-141081983 GGCTGTAGACCATTTAGAGAAGG + Intronic
963638856 3:147834479-147834501 TGCTGAAGTCAATGTCAAGAAGG + Intergenic
963844384 3:150140642-150140664 TGCTGAAGTCCAAGGGGAGTGGG + Intergenic
965098358 3:164264718-164264740 TGCTTAGGACCATCTGGAGAAGG + Intergenic
965710418 3:171551413-171551435 TTCTGAAGTCCTTTTTGAAATGG - Intergenic
967660277 3:192099228-192099250 TAATGAAGAGCATTTGGAGATGG + Intergenic
968040974 3:195589005-195589027 GGCAGAAGTCCAGTTGGAGTGGG + Intergenic
968392864 4:207167-207189 TGCTGTGGTCCATCTGGAGGTGG + Intergenic
970608539 4:17704789-17704811 CCCTGAACTCCCTTTGGAGAAGG + Intronic
970968165 4:21950729-21950751 GGCTGAAGTACATTGAGAGAAGG + Intergenic
971829900 4:31677861-31677883 TATTGAAGTCCATCTGAAGAAGG - Intergenic
975163217 4:71147557-71147579 TGATGGAGTACAGTTGGAGAAGG + Intergenic
976177434 4:82369193-82369215 TGCTGCAGTTCATTTGGGGTAGG - Intronic
977281799 4:95049116-95049138 TCCAGAAGTCTTTTTGGAGATGG + Intronic
978533982 4:109741691-109741713 TCCTGAACTCCATTTCAAGATGG + Intronic
979869581 4:125802199-125802221 TACCCAAGTACATTTGGAGAAGG - Intergenic
982456607 4:155617729-155617751 TGCTGAAGTTCAGTGGGAGTGGG - Intergenic
984427484 4:179606400-179606422 TGCTAAAGTCAATTTGGATAGGG - Intergenic
984924336 4:184793553-184793575 GGCAGATGCCCATTTGGAGATGG - Intronic
985864358 5:2502519-2502541 TGCTGAAACACAATTGGAGAAGG - Intergenic
987069496 5:14322454-14322476 TGCTGAATTCCATCTGGAGGAGG + Intronic
988325732 5:29764782-29764804 TGCCAAAGTCGATTTTGAGAAGG + Intergenic
989615673 5:43334914-43334936 TGCTGGAGTCCTTTTAGAGAGGG + Intergenic
990998674 5:61759524-61759546 TGTTGAAGGACATTTGGAGTGGG + Intergenic
991294091 5:65062565-65062587 TGTTGCAGACCAGTTGGAGATGG - Intergenic
992841912 5:80703615-80703637 TGCTGAAGTCTGCTTGAAGAAGG + Intronic
993106456 5:83606044-83606066 CGCAGAAGTCCATATGAAGATGG + Intergenic
993636048 5:90344954-90344976 TGCAGAAGTCGCATTGGAGATGG + Intergenic
995413830 5:111887498-111887520 TGCTGAAGTCCATTTGGAGAAGG + Intronic
999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG + Intronic
1003799080 6:9641811-9641833 TGCAGAAGTCTATTTACAGAGGG + Intronic
1005060725 6:21774629-21774651 AGCTGAAGACCATTTAGGGAAGG + Intergenic
1005963906 6:30712981-30713003 AGCTGAGGTCCATTTGGAAAGGG - Exonic
1008174718 6:48253190-48253212 TGCTGGAGGCCATTTGAAAAGGG - Intergenic
1012360074 6:98366485-98366507 TGGTGAAGGCCTTTAGGAGATGG - Intergenic
1012366974 6:98453220-98453242 TGCTGTAGTACAGGTGGAGAAGG - Intergenic
1012724590 6:102793717-102793739 TGGTTAAGACCATTGGGAGAAGG + Intergenic
1012978458 6:105805084-105805106 TGTTGAAGTCTAGTTGGTGATGG - Intergenic
1015777288 6:136826518-136826540 GGTTGAAATCCATTTGGGGATGG + Intronic
1016283140 6:142442337-142442359 TCCTAAAGTGTATTTGGAGAGGG + Intronic
1021622631 7:22563609-22563631 GGCTGAACTGCAGTTGGAGAAGG + Intronic
1022342081 7:29478124-29478146 TGGGGAAGTCCTTTTGGAAAGGG + Intronic
1023012276 7:35934975-35934997 TGCTGAAGATTATTTGGAGATGG + Intergenic
1023798307 7:43811823-43811845 CGCTGGAGTCCTTTTAGAGAGGG - Intergenic
1023798794 7:43815129-43815151 CGCTGGAGTCCTTTTAGAGAGGG - Intergenic
1023828968 7:44028372-44028394 AGCTGAAGGCCTTCTGGAGAAGG + Intergenic
1024078850 7:45838878-45838900 TGCTGAAGATTATTTGGAGATGG - Intergenic
1024879158 7:54066392-54066414 TGCTGACTTCAATTAGGAGATGG + Intergenic
1025125931 7:56345065-56345087 TGCTGAAGATTATTTGTAGATGG + Intergenic
1025748664 7:64271271-64271293 TGATGAAGTCCATGTTGAGGTGG + Intergenic
1027258389 7:76445897-76445919 TGCTGAGGCCCATCTGGAGCTGG - Intergenic
1027280459 7:76606121-76606143 TGCTGAGGCCCATCTGGAGCTGG + Intergenic
1028788423 7:94824149-94824171 TAGTGAAGGCCATTTGGATATGG - Intergenic
1029281457 7:99438551-99438573 TGCAGAAGTCCGTGTGGAGAGGG - Intronic
1029556617 7:101274555-101274577 TGCTGAAGATTATTTGGAGATGG + Intergenic
1029739267 7:102482629-102482651 AGCTGAAGGCCTTCTGGAGAAGG + Intronic
1029757268 7:102581808-102581830 AGCTGAAGGCCTTCTGGAGAAGG + Exonic
1029775208 7:102680869-102680891 AGCTGAAGGCCTTCTGGAGAAGG + Intergenic
1032174077 7:129610009-129610031 AGCTGTAGTGGATTTGGAGAGGG + Intergenic
1032485644 7:132285352-132285374 AGCTGGAATCCTTTTGGAGAAGG + Intronic
1033098148 7:138448660-138448682 TGCTGAAGTCCTTTTAGAGAGGG + Intergenic
1035100266 7:156390502-156390524 TGATGAATTCCATTTGTTGAGGG + Intergenic
1037734569 8:21555930-21555952 TGCTGAAGGTCATTAGGAGGAGG + Intergenic
1038435880 8:27535726-27535748 TGCTGAAGTGCTCCTGGAGAGGG + Intronic
1039184797 8:34905172-34905194 TTCTGAACTCCATTGGGAGGTGG + Intergenic
1039325696 8:36483280-36483302 TGATGAAGGCCTTTTGGAGGAGG + Intergenic
1039822005 8:41142659-41142681 TCATGTAATCCATTTGGAGATGG - Intergenic
1041600743 8:59714692-59714714 TGCTGAAGTCCCCTTGCACATGG + Intergenic
1041816373 8:61976490-61976512 TTCTGAAGTCTAGTTGGAGATGG - Intergenic
1042522112 8:69724595-69724617 TGCTGAGGTCCATTGTGAGACGG + Intronic
1043559661 8:81477208-81477230 TGATAAAGTCAATTTGAAGAGGG - Intergenic
1049052326 8:140208457-140208479 TGCTGGACCCCATTTGCAGAGGG - Intronic
1049450892 8:142660894-142660916 AGTTAAAGTCCATTTGGAGGAGG - Intronic
1050797325 9:9560676-9560698 TGCTGAAGTCCAAGGGGAGTGGG + Intronic
1053269577 9:36740698-36740720 TGCTGAGTTCCATTAGGACAGGG + Intergenic
1055989254 9:82087838-82087860 TGCTGTATTCCTTTTTGAGAAGG - Intergenic
1056690774 9:88807032-88807054 TGCTGAGCACCATTTTGAGATGG + Intergenic
1056956947 9:91090252-91090274 TGCTGACCTCCATGGGGAGACGG - Intergenic
1057798589 9:98175411-98175433 TGCTGAAGCCCAGTGGGAGTTGG - Intronic
1057921590 9:99102877-99102899 TGCTTCAGTTCATGTGGAGAAGG - Intergenic
1058244987 9:102611980-102612002 TGATGAAGTCCTTATGGTGACGG - Intergenic
1059542144 9:115141756-115141778 TCCTGAGCTCCCTTTGGAGAGGG - Intergenic
1059636340 9:116174537-116174559 TGCTGAAGAGCATTGGGAGGAGG - Intronic
1059775559 9:117471289-117471311 TGATGCAGGCCATTTGGACAGGG - Intergenic
1186893711 X:13985320-13985342 TTAGGAAGTCCATTTGGAGCTGG + Intergenic
1187590819 X:20715170-20715192 TGCTGATGGCCATTGAGAGAAGG - Intergenic
1187761707 X:22594333-22594355 TAATGAAGTCCATGTGAAGAAGG - Intergenic
1189181107 X:39005249-39005271 TGCAGGAGGGCATTTGGAGAAGG + Intergenic
1189656238 X:43247818-43247840 TGCTGGAGTCAAATTAGAGATGG - Intergenic
1189834315 X:45005130-45005152 CGCTGGAGTCCTTTTAGAGAGGG + Intronic
1193208937 X:78782821-78782843 TGCAGAAGAAAATTTGGAGATGG + Intergenic
1194150907 X:90324182-90324204 TGCTGAAGTCCAGGCTGAGAAGG - Intergenic
1195001259 X:100645411-100645433 TGCTGAGGTACATGAGGAGAGGG - Intronic
1196881897 X:120206454-120206476 TGCTGAAGTCCAGAGGGAGTTGG - Intergenic
1197594555 X:128450348-128450370 TGTGGAAGTGCATTTGGAAATGG - Intergenic
1198275142 X:135093064-135093086 TGGGGAGCTCCATTTGGAGAGGG + Intergenic
1198311328 X:135427338-135427360 TGGGGAGTTCCATTTGGAGAAGG - Intergenic
1200497274 Y:3900942-3900964 TGCTGAAGTCCAGGCTGAGAAGG - Intergenic
1200763561 Y:7061972-7061994 TGCTGGAGTCATTTTAGAGAGGG + Intronic
1201984903 Y:19955012-19955034 TGCTGGAATCCATGTGGAAATGG + Intergenic