ID: 995415937

View in Genome Browser
Species Human (GRCh38)
Location 5:111913273-111913295
Sequence GCACTACTTCATTTTAAAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995415936_995415937 29 Left 995415936 5:111913221-111913243 CCATGTCACTCTAATTTCAAATT 0: 1
1: 0
2: 0
3: 26
4: 401
Right 995415937 5:111913273-111913295 GCACTACTTCATTTTAAAAGCGG 0: 1
1: 0
2: 1
3: 15
4: 215
995415935_995415937 30 Left 995415935 5:111913220-111913242 CCCATGTCACTCTAATTTCAAAT 0: 1
1: 0
2: 2
3: 26
4: 339
Right 995415937 5:111913273-111913295 GCACTACTTCATTTTAAAAGCGG 0: 1
1: 0
2: 1
3: 15
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995415937 Original CRISPR GCACTACTTCATTTTAAAAG CGG Intronic
905162195 1:36046219-36046241 GCACTACTCCATCTTGGAAGTGG + Intronic
905923832 1:41736183-41736205 GCACTCCTTGCTTCTAAAAGTGG - Intronic
909583994 1:77269223-77269245 GCTCTACTTCATTTCAAAATAGG + Intergenic
916531115 1:165657518-165657540 TCAACACTTCATTATAAAAGAGG + Intronic
916881444 1:169023114-169023136 GGTCTAATTCCTTTTAAAAGGGG - Intergenic
918721642 1:187859691-187859713 GCAGTATTTTGTTTTAAAAGTGG + Intergenic
919782117 1:201227737-201227759 CAAATACCTCATTTTAAAAGTGG - Intronic
924629069 1:245720342-245720364 TCACTACTCTATTTCAAAAGAGG + Intergenic
1063080248 10:2761019-2761041 GCACTACTTCATTTACATAGGGG + Intergenic
1063605183 10:7517244-7517266 GTACAACTTCATTTTACAAAGGG - Intergenic
1064742211 10:18445347-18445369 GCAGTACTTAGTATTAAAAGAGG + Intronic
1064944590 10:20773590-20773612 GCAACACATCATTTTAAAAATGG + Intergenic
1068596798 10:58910790-58910812 TCAGAACTTCATTATAAAAGTGG + Intergenic
1072018427 10:91373373-91373395 GCACTAGTTCATTTCTAAGGTGG + Intergenic
1072906173 10:99456125-99456147 CCACTACCTCATTTGTAAAGTGG - Intergenic
1074094577 10:110299416-110299438 GCACAGCTTCATTTAAAAGGGGG + Intronic
1078566069 11:12415405-12415427 ACACCACTTCATTGTCAAAGTGG - Intronic
1081185508 11:40037398-40037420 GCACTAATTCACATTAAATGTGG + Intergenic
1084788258 11:71456673-71456695 GACCTGTTTCATTTTAAAAGTGG + Intronic
1085012416 11:73150427-73150449 GGACTACTGCTTTTTAAAATTGG - Intergenic
1086413795 11:86568984-86569006 GCAGCACTTCATTTAATAAGTGG - Intronic
1087275311 11:96155150-96155172 GCTGTTCTTCATTTTAAAAAAGG - Intronic
1087521149 11:99238122-99238144 GCACTGCATCTTTTTAAAAATGG + Intronic
1088157715 11:106828988-106829010 GCACTGCTATATTTTATAAGAGG + Intronic
1088300657 11:108354958-108354980 GCACTGCTTCATTTTAACATAGG + Exonic
1090067068 11:123512107-123512129 GCACCACCTCATATTCAAAGGGG - Intergenic
1091563640 12:1632268-1632290 GCAGCTCTTCATTTTAATAGAGG - Intronic
1092663392 12:10764804-10764826 TCACTTCTTCATTTTAATGGAGG + Intergenic
1093878690 12:24379191-24379213 CAACTTCTTCATTTTAAAAGGGG - Intergenic
1094052669 12:26238353-26238375 TCACTGCTTCATTTTAATATGGG + Intronic
1095269422 12:40199480-40199502 GCACTGCAACATTTTAAAATAGG - Intronic
1096316335 12:50570137-50570159 GAACTTCTTCATTTTAAATCAGG - Intronic
1096687888 12:53300762-53300784 GCTCAACTTCTTTTGAAAAGAGG - Intronic
1098074044 12:66707595-66707617 GTAACACTTCTTTTTAAAAGAGG + Intronic
1098260243 12:68662469-68662491 GCAAAACTTCATTTTATAAATGG - Exonic
1100077916 12:90809986-90810008 GCACTACTTCATTTGAAGTTGGG + Intergenic
1102324412 12:111967338-111967360 GCACTATTTCATTTGAATTGTGG + Intronic
1105007164 12:132728777-132728799 GCAAAACTGCATTTTAACAGCGG - Intronic
1108296422 13:49023339-49023361 AAATTATTTCATTTTAAAAGTGG + Intronic
1109812902 13:67538833-67538855 ACACTACTCTATTTTAAAAGAGG - Intergenic
1109827812 13:67745627-67745649 TCAATACTTCATTATAAAAGAGG + Intergenic
1111288160 13:86122684-86122706 GCTTTACTTTATTTTAAAAAAGG - Intergenic
1111624770 13:90770742-90770764 GCAGTAGTTTATTTTAAAAGGGG - Intergenic
1111683756 13:91476323-91476345 GAATCACTTCATTTTAATAGTGG + Intronic
1112478443 13:99752934-99752956 CCAATAATTCATTTCAAAAGGGG + Intronic
1112674657 13:101686220-101686242 GAACTGCTTCATTCTAATAGGGG - Intronic
1112681935 13:101776951-101776973 TAACAACTTCATTTTAAAAAAGG - Intronic
1113517943 13:110917382-110917404 GAACTACTCCATCTTAAATGGGG + Intergenic
1115692773 14:35862266-35862288 GACCTACTTAAATTTAAAAGGGG + Intronic
1115908606 14:38230246-38230268 GCAATAGTTAATTTTAAAAAGGG - Intergenic
1117059426 14:51946953-51946975 GCACTAATTGATTCTAAAAGTGG + Intronic
1117098043 14:52316853-52316875 GTCCGACTTCATTTTATAAGAGG - Intronic
1118462918 14:66003116-66003138 ACCCTACATCATTTTACAAGTGG + Intronic
1118725957 14:68629098-68629120 GCCCAACTTCATTTTAGCAGTGG + Intronic
1120326243 14:83031718-83031740 GCATGATTTCCTTTTAAAAGTGG - Intergenic
1120548402 14:85839272-85839294 GCACCCCTTCATGTTAAAGGAGG - Intergenic
1120915249 14:89704660-89704682 GCCCTACTTCCTTATAATAGTGG + Intergenic
1121350871 14:93171673-93171695 CCAAAACTTCATTTTAAAAAAGG + Intergenic
1123169014 14:106353721-106353743 GCAGTACTTGATTGTAACAGTGG + Intergenic
1123693140 15:22855927-22855949 GCACTAATTCACTGTGAAAGGGG - Intronic
1125250786 15:37700648-37700670 TCAATACTTCATTATAAAATAGG - Intergenic
1127348260 15:58123707-58123729 GCAAAACATCATTTTAGAAGAGG - Intronic
1128295702 15:66517475-66517497 TCAATACTTCATTTTTAAAATGG - Intronic
1128421324 15:67493957-67493979 GTACGAGTTCATTTTAAAAATGG - Intronic
1131877107 15:96819781-96819803 TCAATACTTCATTATAAAATAGG + Intergenic
1137994642 16:53197169-53197191 AGACTCCTTCATTTTAAAATGGG + Intronic
1141104397 16:81221423-81221445 GAATTTGTTCATTTTAAAAGTGG - Intergenic
1141263388 16:82474056-82474078 GCACCACTACATTTTAATAGGGG + Intergenic
1145267850 17:21389082-21389104 GCACAACTGCAGTTTAAATGGGG - Intronic
1147421677 17:40324947-40324969 GCCCAGCCTCATTTTAAAAGAGG - Intronic
1149158746 17:53665893-53665915 GTACTAATTTATCTTAAAAGTGG - Intergenic
1151299126 17:73209337-73209359 GCACTATTGCAATTTCAAAGGGG - Exonic
1152940033 17:83164290-83164312 GAACAACTTGATTTTAAAATGGG - Intergenic
1154943690 18:21138761-21138783 GAACTTCTCCATTTTAATAGAGG - Intergenic
1157167261 18:45369399-45369421 GTACATCTGCATTTTAAAAGAGG + Intronic
1159131478 18:64284957-64284979 GCACTATTTCCTTACAAAAGAGG + Intergenic
1165222215 19:34325641-34325663 GCTCGCCTTCATTTTAAAATTGG + Intronic
1166821645 19:45584220-45584242 GGGCAACTTCATTTCAAAAGCGG - Intronic
926260269 2:11253730-11253752 GCAAAAATTTATTTTAAAAGTGG + Intronic
926427482 2:12752530-12752552 TCAATACTTCATTATAAAATAGG + Intergenic
927563726 2:24092795-24092817 GCTCTAGTTCATTTTTCAAGTGG - Intronic
928376538 2:30778970-30778992 GCCCTACACCATTTTAAAACTGG - Intronic
929591401 2:43149477-43149499 GCTCTATTTCCCTTTAAAAGAGG - Intergenic
929850432 2:45583616-45583638 TCACTATTTCATTTTTTAAGTGG + Intronic
931362429 2:61589286-61589308 GAACAACTGGATTTTAAAAGCGG - Intergenic
931679353 2:64731134-64731156 GAACCACTTCATTTTCAGAGTGG + Intronic
933203468 2:79478086-79478108 GTACTACTTCAACTTAAAAAAGG + Intronic
933273481 2:80258960-80258982 GCACTTCTCCTTTTTAAATGGGG - Intronic
933372442 2:81432755-81432777 ACCCTACTTCATTTAAAAATAGG + Intergenic
933458311 2:82545099-82545121 GGAAATCTTCATTTTAAAAGGGG + Intergenic
935564830 2:104594906-104594928 TCACTACTTCACTATAAAATAGG + Intergenic
938929015 2:136069693-136069715 GCACTACTGCATTTTCGAATGGG + Intergenic
939442481 2:142267119-142267141 TCATTATTTCATTTTCAAAGTGG + Intergenic
941160028 2:162025406-162025428 TCTCAACTTCATTTTCAAAGGGG + Intronic
942351075 2:175053745-175053767 GCAGAACTTCTTTCTAAAAGTGG - Intergenic
942808850 2:179971882-179971904 CCACTACTTCTTTTTACTAGGGG + Intronic
944277721 2:197858292-197858314 GCATTACTTTATTTTACAAGAGG - Intronic
945325229 2:208474132-208474154 AGAAAACTTCATTTTAAAAGGGG - Intronic
948279502 2:236735996-236736018 GCAGTAATGCTTTTTAAAAGGGG + Intergenic
1173755999 20:45516698-45516720 TCAACACTTCATTATAAAAGGGG + Intergenic
1174712976 20:52726876-52726898 AAAATACTTCAATTTAAAAGGGG - Intergenic
1175672850 20:60920922-60920944 ACACTGCTTCATTGTAGAAGGGG - Intergenic
1177636891 21:23798895-23798917 GCACTACTACAGTTTAACACAGG + Intergenic
1178071197 21:28968908-28968930 GCACTACATCTTTCTAAAACAGG + Intronic
1183751230 22:39721924-39721946 GCACTGACTCATTTTGAAAGTGG + Intergenic
1185264788 22:49895348-49895370 ATTCTGCTTCATTTTAAAAGTGG + Intergenic
949603868 3:5632941-5632963 GCACTACTCCATTTAACAAATGG - Intergenic
951319909 3:21231913-21231935 GAACTATTTCAGTGTAAAAGTGG - Intergenic
951409865 3:22349628-22349650 GAAATCCTTCATTTTAAAAAAGG + Intronic
952417868 3:33105910-33105932 TGATTACTTCATTTTAAAAAAGG - Intergenic
952820958 3:37485202-37485224 GCATTATTTCATTTTACAATTGG + Intronic
953206573 3:40835732-40835754 GCAGCATTTCATTGTAAAAGTGG - Intergenic
953593917 3:44289375-44289397 GCTCAATTTTATTTTAAAAGAGG - Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
957318835 3:78603226-78603248 GTACTACTACATAATAAAAGTGG - Intronic
957363575 3:79191919-79191941 TAACTACTTTATTTTTAAAGAGG + Intronic
957788358 3:84909180-84909202 GCACCACCTGATTTAAAAAGTGG + Intergenic
957807266 3:85164822-85164844 GCACGATTTTAATTTAAAAGTGG - Intronic
957858302 3:85908090-85908112 CCAAAACTTCATTCTAAAAGTGG + Intronic
958260351 3:91373474-91373496 ACATTACTTCAGTTTTAAAGTGG - Intergenic
958614814 3:96479343-96479365 GAAGTACTTCATTGTAAAATGGG - Intergenic
959769989 3:110082635-110082657 GAACCACTTCATTTTGAAATTGG - Intergenic
959825415 3:110789221-110789243 GAACCCCTTCATTCTAAAAGTGG - Intergenic
959904452 3:111694943-111694965 CCACTACTTCATTTTACAAATGG - Intronic
960656609 3:120011290-120011312 GTTCTACTTCTTTTTAAAAAAGG + Intronic
961075823 3:123980714-123980736 GCCCTTGTTCATTTAAAAAGTGG + Intronic
962186444 3:133265316-133265338 GAAATAGTTCATTTTAAAATGGG + Intronic
963473153 3:145769987-145770009 GTACTAAAACATTTTAAAAGGGG + Intergenic
965470774 3:169087818-169087840 CCATTTCTTCATTGTAAAAGGGG - Intronic
967074154 3:185987234-185987256 CCACTACTTCTCTATAAAAGGGG - Intergenic
967555815 3:190857202-190857224 GAAATAGCTCATTTTAAAAGTGG + Intronic
967727808 3:192878328-192878350 GGACTAAGTCATTTAAAAAGTGG + Intronic
972001736 4:34045071-34045093 GCAGTACTTCTTAATAAAAGGGG - Intergenic
972955195 4:44380827-44380849 GCACTTCAACATTTTATAAGAGG - Intronic
973807129 4:54537385-54537407 ATACAATTTCATTTTAAAAGAGG - Intergenic
974798809 4:66787885-66787907 GAATTAATTAATTTTAAAAGTGG + Intergenic
975327183 4:73071771-73071793 GCACAAGTTCATTTGCAAAGAGG - Intergenic
975622630 4:76308997-76309019 GTAGTACTTGATTTTAATAGAGG + Intronic
976467772 4:85390123-85390145 AAATTACTTCATTTTAAAAATGG - Intergenic
976757108 4:88510336-88510358 GCATTACTACATCTCAAAAGGGG + Intergenic
976942258 4:90717545-90717567 CCACTACTTCATTCTCTAAGTGG - Intronic
976993394 4:91399059-91399081 AAACCACTTAATTTTAAAAGTGG + Intronic
977243782 4:94605083-94605105 AAACTACTGCATTTTAAAAGAGG + Intronic
978960816 4:114675844-114675866 GCATATCTTCATTTAAAAAGGGG - Intronic
980339448 4:131524518-131524540 GTACTACTCCATTTTATAAAAGG + Intergenic
981675674 4:147340187-147340209 TCAATACTACCTTTTAAAAGGGG + Intergenic
982109079 4:152036996-152037018 GGACCACTTAATTTTAACAGAGG + Intergenic
982272821 4:153608845-153608867 TCAGTAATTCCTTTTAAAAGTGG - Intronic
983014878 4:162601090-162601112 GAACTGCTTCATTCTGAAAGTGG - Intergenic
983368616 4:166829471-166829493 GCTCTACTTGATTAAAAAAGTGG - Intronic
983788096 4:171759599-171759621 GGACTGCTGCATTTTTAAAGAGG - Intergenic
985099516 4:186444557-186444579 GCCCTACTTCTTATCAAAAGAGG + Intronic
986396932 5:7340324-7340346 GTTTTGCTTCATTTTAAAAGAGG - Intergenic
986970979 5:13336219-13336241 GCACTGCTTTGTATTAAAAGAGG - Intergenic
987194140 5:15508182-15508204 TCAGTACTTCATTATAAAACAGG - Intronic
988328613 5:29805066-29805088 GAACTACTTCATTCTAATAAAGG + Intergenic
989376003 5:40761961-40761983 ACACTACAGAATTTTAAAAGGGG + Intronic
989498048 5:42132097-42132119 GCACTGCTTAATGTTAACAGTGG - Intergenic
990651009 5:57899449-57899471 CCTCTTCTTCATTTTATAAGGGG - Intergenic
990794717 5:59526470-59526492 GCTTTACCTGATTTTAAAAGTGG - Intronic
991192019 5:63885468-63885490 GCCTTACTTCATTTGAAGAGAGG - Intergenic
991721153 5:69494802-69494824 GTAGAACTCCATTTTAAAAGTGG + Intronic
992398219 5:76386974-76386996 GCACTTGTTCATTTTCACAGGGG - Intergenic
992959421 5:81943900-81943922 TCAATACTTCATTATAAAACAGG + Intergenic
994028117 5:95108471-95108493 CCACTAATATATTTTAAAAGTGG + Intronic
994293254 5:98055838-98055860 GCACAAATCCATTTTAAAATAGG + Intergenic
995026741 5:107432294-107432316 GCTCTAGCTCATATTAAAAGAGG + Intronic
995415937 5:111913273-111913295 GCACTACTTCATTTTAAAAGCGG + Intronic
995652732 5:114388883-114388905 GCCCTTCTGCATTTGAAAAGAGG + Intronic
995891328 5:116955517-116955539 TCTCTACTTCATTTTCAATGTGG - Intergenic
996154334 5:120079654-120079676 GCAATCCTTCATTTTCAAAAAGG - Intergenic
996711171 5:126545079-126545101 GATCTGCTACATTTTAAAAGTGG - Intronic
999434988 5:151556702-151556724 TCAATACTTTATTTTAAAATAGG + Intronic
1000265734 5:159634555-159634577 ACACTATTTCATTTTATAATTGG - Intergenic
1000287832 5:159843004-159843026 ACACTACGTCATTTTAAATCAGG + Intergenic
1002363125 5:178689168-178689190 GCAGGACTTCTTTTTTAAAGTGG + Intergenic
1004131507 6:12924847-12924869 CCACTTCTTCATTTTAAAGTTGG - Intronic
1004306583 6:14506795-14506817 GGACTACTTCATTCTGAAAAGGG - Intergenic
1004554211 6:16679727-16679749 ACAATACTTAATTTTAAAAGAGG - Intronic
1004963513 6:20820708-20820730 GTACTACTACCTTATAAAAGAGG - Intronic
1005134558 6:22553093-22553115 GTACTACTTCATTTTATATAAGG + Intergenic
1008273345 6:49515688-49515710 ACACCACTTCCTTTTGAAAGGGG - Exonic
1010374143 6:75146954-75146976 GCACTCCTTCTTCTTAAAAGTGG + Intronic
1012632385 6:101487379-101487401 TCAGTACTACATTTTAAAACTGG + Intronic
1014673823 6:124340163-124340185 TCACTACTTGTTTTTAGAAGTGG - Intronic
1015075883 6:129157296-129157318 GGACAACTTTATTTTAAATGTGG - Intronic
1015624094 6:135161836-135161858 GCATTATTTCACTTAAAAAGGGG + Intergenic
1016263160 6:142198649-142198671 GCAGTTCTTCTTTATAAAAGGGG - Intronic
1016708729 6:147144475-147144497 TCACTACTAAATCTTAAAAGGGG - Intergenic
1017462514 6:154664793-154664815 GCCCTACTCCAGTGTAAAAGGGG + Intergenic
1017605732 6:156130425-156130447 GAAATACTTCATTTTCACAGTGG - Intergenic
1018603340 6:165570574-165570596 ACACTACTTAATTTTAAAAGAGG + Intronic
1020767251 7:12338879-12338901 GCACTATAGAATTTTAAAAGAGG - Intronic
1021346310 7:19532951-19532973 ACACTACTCCATTTAAAAATGGG + Intergenic
1023758604 7:43443519-43443541 GCACTAATGCATTTGAAATGGGG + Intronic
1024525331 7:50343580-50343602 GAACTACTTCTTTGTACAAGAGG + Intronic
1028233652 7:88334435-88334457 ACACTGCTTCATTGTAAGAGTGG + Intergenic
1030149250 7:106386426-106386448 TCAATACTTCATTGTAAAATAGG - Intergenic
1033528399 7:142239997-142240019 TCACAACTTCATATTAAATGTGG - Intergenic
1036737963 8:11336075-11336097 TCACTCCTTCATGATAAAAGAGG + Intergenic
1037323262 8:17663903-17663925 ACATTTCTTCATTTTTAAAGTGG + Intronic
1037487124 8:19358168-19358190 TCACTATGTCATTTTAAATGGGG + Intronic
1037757602 8:21721388-21721410 GCACTTCTTCATGTTAAGAGTGG - Intronic
1038379929 8:27083334-27083356 GCTCTACTTAACTTTTAAAGAGG - Intergenic
1039059673 8:33563738-33563760 GCACTATTTGATGTTACAAGAGG + Intronic
1039179522 8:34849730-34849752 GCAGAAATTCATATTAAAAGTGG - Intergenic
1041194012 8:55382330-55382352 GCACAACTGCTTTTGAAAAGTGG - Intronic
1044548185 8:93482695-93482717 AGACTACATCATTTAAAAAGGGG + Intergenic
1047682871 8:127272839-127272861 CCACTACTTCATTTACATAGGGG + Intergenic
1048654529 8:136521222-136521244 AAACTACCCCATTTTAAAAGGGG - Intergenic
1050257462 9:3810188-3810210 CAACTCCTTGATTTTAAAAGTGG + Intergenic
1050782020 9:9348947-9348969 ACACTACTTCCTATTAAAATAGG - Intronic
1051022985 9:12568326-12568348 ACACTACTTGATTTTAAACCAGG + Intergenic
1051980381 9:23007562-23007584 GTGCTACTTCATTTCAAAAAAGG - Intergenic
1052372623 9:27682807-27682829 TCACTACCCCATTTTAAATGTGG - Intergenic
1053231978 9:36417818-36417840 GCAGTGTTTCATTTAAAAAGTGG - Intronic
1055076182 9:72217617-72217639 GATTTACTTCATTTTACAAGAGG - Intronic
1056339431 9:85610780-85610802 GCAATAATTCATTTTAAGGGTGG - Intronic
1058118989 9:101117903-101117925 GTACCACTTAATTTGAAAAGAGG - Intronic
1059982996 9:119793726-119793748 GTCCTACTTTATTTTCAAAGGGG + Intergenic
1060526072 9:124322031-124322053 CCACTACCTCATTTTAAAGAAGG + Intronic
1061614192 9:131768650-131768672 GAGCTAATTCATTTTAAATGAGG - Intergenic
1187085740 X:16041818-16041840 GCATTCCTCTATTTTAAAAGTGG + Intergenic
1189210986 X:39282151-39282173 AAACAACTTCATTTAAAAAGTGG + Intergenic
1192359244 X:70428278-70428300 TCAATACTTCATTATAAAATAGG + Intronic
1192477364 X:71454540-71454562 GGAATACTACATTTTAAAATAGG - Intronic
1193469355 X:81880092-81880114 GCACTGCATCATTATAAATGTGG - Intergenic
1193580055 X:83252881-83252903 GCACTACTGCAAATGAAAAGTGG + Intergenic
1193641432 X:84013845-84013867 GCATTATTTCATTTTGAAAATGG - Intergenic
1194568168 X:95519908-95519930 CAAATACTCCATTTTAAAAGTGG + Intergenic
1194680015 X:96841250-96841272 GCATTACTTTATTTAATAAGAGG - Intronic
1196002479 X:110801074-110801096 GCAATACTTAATTTCAAAAAGGG - Intergenic