ID: 995420097

View in Genome Browser
Species Human (GRCh38)
Location 5:111955000-111955022
Sequence ATGAAGATGCATGAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 6, 3: 49, 4: 507}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995420097 Original CRISPR ATGAAGATGCATGAGGAAGA AGG Intronic
900593855 1:3471637-3471659 ATGCAGCTGCCTGAGGCAGAGGG - Intronic
901234243 1:7659060-7659082 GTGAAGATGCAGGAGGCAGAGGG + Intronic
902489575 1:16771412-16771434 AAGAAGAAGAAGGAGGAAGAGGG + Intronic
902787658 1:18743543-18743565 ATCCAGAAGCAAGAGGAAGATGG - Intronic
903189146 1:21646828-21646850 GTGCAGATGCAAGAGGAAGGAGG - Intronic
903350955 1:22716291-22716313 ATGAAGAGCCTTGAGGAAGTAGG - Intronic
906180836 1:43817507-43817529 AGGAAGAAGAATGAAGAAGAAGG - Intronic
906693762 1:47810535-47810557 CTGGAGATGCATGAGCAAGGGGG + Intronic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
907903427 1:58762470-58762492 ATGAAGCTGGAGGAGTAAGAAGG + Intergenic
908848058 1:68344973-68344995 GTGGAGATGAATGAGGTAGAGGG + Intergenic
909949245 1:81700024-81700046 ATGCAGAGAAATGAGGAAGATGG + Intronic
910107881 1:83651249-83651271 ATGGAGAGGAATGAGGAAGGAGG + Intergenic
910126210 1:83845352-83845374 ATGAAGATGCAGGAAAAAGAGGG + Intergenic
910269871 1:85382560-85382582 ATGAATATGGTTGATGAAGATGG + Intronic
911058266 1:93726024-93726046 AAGAAGAAGAATAAGGAAGAGGG - Intronic
911426997 1:97729350-97729372 ATAAATATGCCTGACGAAGAAGG - Intronic
911733234 1:101311195-101311217 ATCAAGATGCAAAAGGAAGTTGG - Intergenic
913559627 1:120004606-120004628 ATGAAGAAGCAAAAGGAACAGGG + Intronic
913638233 1:120785935-120785957 ATGAAGAAGCAAAAGGAACAGGG - Intergenic
914280215 1:146164027-146164049 ATGAAGAAGCAAAAGGAACAGGG + Intronic
914541260 1:148614966-148614988 ATGAAGAAGCAAAAGGAACAGGG + Intronic
914625380 1:149456279-149456301 ATGAAGAAGCAAAAGGAACAGGG - Intergenic
915663958 1:157427889-157427911 ATTAAGAAGAATGAGAAAGAAGG + Intergenic
915860547 1:159439931-159439953 ATGAAGATCCATTCGGATGATGG - Exonic
915867259 1:159516165-159516187 ATAAAGATGCATGAATAAGAGGG - Intergenic
915984878 1:160454621-160454643 ATGAAGAAGAGTGAGGTAGACGG + Intergenic
916926634 1:169528184-169528206 ATGCAGAATCATGAGGAACATGG - Intronic
917966835 1:180184124-180184146 AGGAAGAAGAATGAGCAAGAGGG - Intronic
918565719 1:185929148-185929170 ATGAATATGGAAGAGGAAAAGGG - Intronic
919426914 1:197444327-197444349 AAGAAAATGGATGAGTAAGAAGG - Intronic
920400524 1:205673307-205673329 ATGAACATGGAGGGGGAAGAGGG + Intronic
920512599 1:206562073-206562095 AGGAAGATGCAAGAGGAAGAGGG + Intronic
920550447 1:206856228-206856250 AGGAAGGAGCAAGAGGAAGACGG - Intergenic
920802138 1:209199352-209199374 ATTAATGTGCATGAGCAAGAGGG - Intergenic
920832078 1:209474533-209474555 ACCAAGAGGCATGAGGCAGAGGG - Intergenic
921179306 1:212619225-212619247 ATCAAGCTGCGAGAGGAAGATGG - Intronic
921458717 1:215403760-215403782 GTGAAGATACAGGAAGAAGATGG - Intergenic
922722740 1:227906839-227906861 AGGAAGGAGGATGAGGAAGAGGG - Intergenic
922898290 1:229117385-229117407 ACAAAGATGCAGGATGAAGATGG + Intergenic
923068989 1:230545670-230545692 CTGATGTTGCATGAGAAAGAAGG + Intergenic
923144507 1:231188457-231188479 ATAAAGATGCAGCTGGAAGATGG + Intronic
923216816 1:231856266-231856288 ATGAAGAGGCAGGAAGAAGGTGG + Intronic
923530862 1:234811113-234811135 AAGAAGAAGAAGGAGGAAGAGGG - Intergenic
923703293 1:236320366-236320388 GTGAAGATGGATGGGGAAAAAGG - Intergenic
924260974 1:242231217-242231239 AGGAAGAGGGAGGAGGAAGAGGG - Intronic
1062886502 10:1020645-1020667 ATGAAGCACCATGAGGATGAAGG - Intronic
1063538129 10:6905386-6905408 TGGAATATGCAGGAGGAAGAAGG - Intergenic
1065181961 10:23135539-23135561 ATGAAGAGGCATCAGAAAGGAGG + Intergenic
1067211551 10:44263786-44263808 GTGTAGATACAGGAGGAAGATGG + Intergenic
1068207147 10:53870564-53870586 CTGAACATACTTGAGGAAGAGGG - Intronic
1068398118 10:56490443-56490465 AGGCAGATGAATGATGAAGAAGG + Intergenic
1068483467 10:57625796-57625818 ATGAAGACACTGGAGGAAGACGG - Intergenic
1069146673 10:64901350-64901372 AGGAAGATGCTTGAAGAAAAAGG - Intergenic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1070285860 10:75083261-75083283 AAGAGGATGCTTGAAGAAGAGGG - Intergenic
1071099992 10:82024870-82024892 ATGATGTGGAATGAGGAAGACGG - Intronic
1071514655 10:86289266-86289288 ATGAAACTGAGTGAGGAAGAGGG + Intronic
1071575244 10:86720824-86720846 AAGAAGATCCAGGAAGAAGACGG + Intronic
1072022531 10:91417074-91417096 CAGAAGATGAATGAGGAAGTAGG + Intronic
1072762195 10:98065876-98065898 ATGAAGCTGCCTGAGGAAGGTGG + Intergenic
1073429471 10:103476859-103476881 ATGCAGATGCTTGAGGTAGGAGG - Intronic
1073719226 10:106147523-106147545 AAAAAGATGTTTGAGGAAGAGGG + Intergenic
1075718598 10:124571830-124571852 ATGGCGATGGATGAGGAAGTTGG + Intronic
1075954443 10:126510008-126510030 GTAAAGATGCAGGAAGAAGATGG - Intronic
1075994754 10:126868278-126868300 ATGAACATGGGTGTGGAAGATGG - Intergenic
1076129824 10:128005935-128005957 ATGAAGATGGAGGTGGAAGCTGG - Intronic
1076435799 10:130440504-130440526 ATGAAGATACATGAAGACAATGG + Intergenic
1076475363 10:130748064-130748086 ATGAAGATTCATGTCGAAGTTGG - Intergenic
1076496724 10:130902257-130902279 ATGATGATGTATGAGGACGATGG + Intergenic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1078455421 11:11470990-11471012 AGGAAGATACAGGAGAAAGAGGG - Intronic
1078719932 11:13875114-13875136 ATTAGGATGCATGTGGAAGGGGG + Intergenic
1078935075 11:15942654-15942676 AGGAAGAAGCAAAAGGAAGAAGG + Intergenic
1079065201 11:17285105-17285127 AAGAAGAGGGTTGAGGAAGATGG + Intronic
1079170818 11:18093786-18093808 ATCAAGATGCAAGAGGAGGAGGG + Intronic
1079721039 11:23814869-23814891 AAGAAGATAGAAGAGGAAGAAGG - Intergenic
1080825957 11:35849643-35849665 GTGAAGATGCAGGGAGAAGATGG - Intergenic
1081023112 11:37971842-37971864 ATGGAGATGAAGGTGGAAGAGGG - Intergenic
1081108681 11:39104743-39104765 GTGAAGACACAGGAGGAAGATGG - Intergenic
1081580362 11:44347571-44347593 AGGAAGAGGCAAGAGGAAGCCGG - Intergenic
1081648684 11:44808289-44808311 CTCAAGATGCTGGAGGAAGATGG - Intronic
1081658146 11:44871288-44871310 ATGAAGATACAAGGCGAAGATGG - Intronic
1081740869 11:45439124-45439146 ATAAGGATGCATGTGGAATAAGG + Intergenic
1082082470 11:48022871-48022893 GGGAAGATGCAGGAGGAAGTAGG + Intronic
1082216226 11:49573138-49573160 ATGATGATACAAGATGAAGATGG - Intergenic
1082230599 11:49761250-49761272 GTGAAGATGCAAGGAGAAGATGG - Intergenic
1083225672 11:61282969-61282991 ATGGAGATGAGGGAGGAAGAGGG - Intronic
1085168012 11:74421589-74421611 ATGAAAATAAATGAGTAAGATGG - Intergenic
1085923979 11:80992271-80992293 ATGAAGATGCATGAAGGAAGTGG - Intergenic
1086302509 11:85442919-85442941 AAGAAGAAGAAGGAGGAAGAAGG + Intronic
1086619454 11:88867721-88867743 GTGAAGATGCAAGGAGAAGATGG + Intronic
1087676597 11:101169645-101169667 ATGAGAATGTATGAGGAAGAAGG + Intergenic
1088275373 11:108080071-108080093 ATCAAGAGTCATGAGGGAGACGG - Intronic
1088429121 11:109738619-109738641 ATGAACATGAATGAGGAAAATGG - Intergenic
1089047233 11:115512758-115512780 ATGAAGATGCAAAAGAAAAATGG + Intergenic
1089067297 11:115671428-115671450 ATGAAGAAAAATGAGGAAGAGGG - Intergenic
1089248224 11:117137852-117137874 CTGAAAATTCCTGAGGAAGATGG + Intergenic
1089258487 11:117206709-117206731 CTGAAAATTCCTGAGGAAGATGG - Exonic
1089797399 11:120992802-120992824 ATGTAGATGCATGAGGTAAAAGG + Intergenic
1089803328 11:121057592-121057614 TTGAAAATACATGGGGAAGAAGG + Intronic
1089872122 11:121684869-121684891 GTGAAGACACATGAGGAAGGTGG + Intergenic
1091047855 11:132341019-132341041 CTGAGGATGTAAGAGGAAGAGGG + Intergenic
1091522163 12:1256334-1256356 ATGAAAATTCATGAGGAAACAGG + Intronic
1091537388 12:1424646-1424668 ATGAAGAAACAAGAGGAAAAGGG - Intronic
1092042345 12:5395771-5395793 AGGAAGAAACATGAGGAAGAAGG - Intergenic
1092242956 12:6846779-6846801 GAGAGGATGCCTGAGGAAGAGGG - Exonic
1093862084 12:24178332-24178354 ATGAAGATTCATTAGGAAAAGGG + Intergenic
1094630051 12:32165116-32165138 ATAAAGATGGATTAGGAAAATGG + Intronic
1095645243 12:44537280-44537302 ATTACTATGCATGAGAAAGAGGG - Intronic
1096520288 12:52181096-52181118 TAGAAGATGCAAGAGGGAGAAGG - Intronic
1097731733 12:63135902-63135924 AAGAAGTTGCAGGTGGAAGACGG + Intergenic
1097826121 12:64176319-64176341 ATGATGATGATTGAGGATGATGG + Intergenic
1098104164 12:67052235-67052257 ATGAAGATGGTTGAGGGAGGGGG - Intergenic
1098753623 12:74328530-74328552 ATGTGTATGCATGAAGAAGAAGG - Intergenic
1098881087 12:75918349-75918371 ATGAACACTCATGAGGGAGAAGG - Intergenic
1099312611 12:81046643-81046665 AGGAAGAGGAATGTGGAAGAAGG + Intronic
1099424859 12:82511032-82511054 CTAAAGATGAAGGAGGAAGATGG - Intergenic
1099608761 12:84838448-84838470 ATGAAGATAGATGAAGCAGAAGG + Intergenic
1099868957 12:88322107-88322129 ATAAACATCCATGAGGAGGATGG + Intergenic
1100085426 12:90904630-90904652 ATTAAAATGCTTGAGGAAGTGGG - Intergenic
1100283460 12:93140759-93140781 ATGATGATGCACGGGGTAGAAGG - Intergenic
1101752389 12:107592988-107593010 ATGAATATGCATTATAAAGAAGG + Intronic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1102194378 12:111014195-111014217 ATGAAGATGGAAGAAGAAGAGGG + Intergenic
1102394298 12:112574366-112574388 ATGAAGGTGGAGGAGGGAGAGGG + Intronic
1102394321 12:112574435-112574457 ATGAAGGTGGAGGAGGTAGAGGG + Intronic
1102394332 12:112574474-112574496 ATGAAGGTGGAGGAGGGAGAGGG + Intronic
1102394340 12:112574501-112574523 ATGAAGGTGGAGGAGGGAGAGGG + Intronic
1102394405 12:112574702-112574724 ATGAAGGTGGAGGAGGGAGAAGG + Intronic
1102394433 12:112574791-112574813 ATGAAGGTGGAGGAGGGAGAGGG + Intronic
1102394485 12:112574945-112574967 ATGAAGATGGAGGAGGGAGGAGG + Intronic
1102588740 12:113941706-113941728 CTCAAGATGGATGAGGAGGATGG - Intronic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104329631 12:127832430-127832452 ATGATGATGGATGATGATGATGG - Intergenic
1105399421 13:20075523-20075545 ATGAAAATGTTTGAGGAAGAAGG + Intronic
1107162235 13:37244269-37244291 ATGAAAATGAATTGGGAAGAGGG - Intergenic
1107269968 13:38603832-38603854 ATCAGGATGCATGAGAAAAAAGG + Intergenic
1107286993 13:38804715-38804737 ATGTAGATGAATGAAGAATAAGG + Intronic
1108006108 13:45948312-45948334 ATGAAGAAGCAGCAGCAAGAGGG - Intergenic
1108410229 13:50138426-50138448 AAGAAGATGGATGAGGAGGAGGG + Intronic
1108499455 13:51056297-51056319 TTGCAGATGCCTGAGAAAGAGGG - Intergenic
1109342488 13:61078781-61078803 AGGAAGATGCTGGAGGAAGTTGG - Intergenic
1111185530 13:84729410-84729432 GTGAAGTTGAATGAGTAAGAAGG - Intergenic
1112612963 13:100974827-100974849 AAGAAGATGGATAAGGCAGATGG + Intergenic
1112616735 13:101014269-101014291 ATGAAAGTGCCTGAGGCAGAAGG - Intergenic
1113555961 13:111234731-111234753 ATGAAGATGAATGAAAAAAAGGG - Intronic
1114954433 14:27799631-27799653 AGGTAGATGCATCAGGAGGAGGG + Intergenic
1115145384 14:30220203-30220225 ATGTAAATTCATAAGGAAGATGG + Intergenic
1116111798 14:40594539-40594561 ATGAAGATGCATCAGGAAGTCGG + Intergenic
1116637441 14:47415807-47415829 GTGAGGATGCAGCAGGAAGACGG - Intronic
1116802140 14:49454142-49454164 GTGAAGATGGGTGAGGAGGAAGG - Intergenic
1117682455 14:58218674-58218696 ATGTAGATCCAGGTGGAAGAAGG + Intronic
1118009583 14:61595906-61595928 TTGAAGATGAATGAGTCAGAGGG + Intronic
1118269098 14:64325357-64325379 ATGAATTTGCATTAGAAAGAAGG + Intronic
1118325871 14:64779985-64780007 ATGCAGATGAATGAAGAAGATGG - Intronic
1118341475 14:64896898-64896920 AGGAAGATGTATGTGGCAGATGG + Intergenic
1118923209 14:70168505-70168527 AGGAAAAGGCATGAGGAAAAAGG + Intronic
1121229278 14:92344756-92344778 CTGAAGATGAGTGAGGGAGAGGG + Intronic
1122122502 14:99561951-99561973 AGGAAGAGGGATGAGGAAGGAGG - Intronic
1122418949 14:101563589-101563611 AGGAGGATGGAGGAGGAAGAGGG + Intergenic
1122572895 14:102719641-102719663 CGGAAAATGCATCAGGAAGAGGG + Intronic
1202935311 14_KI270725v1_random:82424-82446 ATCCAGATGCTTCAGGAAGATGG + Intergenic
1125010777 15:34871671-34871693 ATTAAGAAACATGAGGAAGGAGG - Intronic
1125673798 15:41491986-41492008 ATGAAGGGGTAAGAGGAAGAAGG - Intergenic
1126570526 15:50145925-50145947 ATGAAAATGAATGAGAAAGATGG + Intronic
1126860293 15:52876584-52876606 ATGAAGATGATTGAGGGAGCTGG - Intergenic
1126896174 15:53259064-53259086 CTGAAGAGGCAGGAAGAAGAAGG + Intergenic
1127281069 15:57493618-57493640 ATGAAGACGCATGAGTTAGTAGG + Intronic
1127503176 15:59573577-59573599 ATGAACAAGGAAGAGGAAGAGGG + Intergenic
1127664654 15:61133834-61133856 CTGATGATGCAGTAGGAAGAAGG - Intronic
1128095670 15:64952813-64952835 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1128911940 15:71523561-71523583 ATGCTGATGTATTAGGAAGATGG + Intronic
1129011357 15:72420771-72420793 CTGAAGCAGAATGAGGAAGAGGG - Intergenic
1129955488 15:79632863-79632885 AAGAACAGGCATGAGAAAGATGG + Intergenic
1130920035 15:88336058-88336080 ATGTGGACGCATGAGGATGAGGG + Intergenic
1130959815 15:88652360-88652382 ATGGAGATGGGTGAGGAGGAGGG - Intronic
1131462911 15:92632175-92632197 ATGAGGATTCATGAGGAAAATGG + Intronic
1131938385 15:97533436-97533458 ATGCATATGCAGGAGGGAGATGG + Intergenic
1132295592 15:100731998-100732020 ATGAACAAGGATGAGGAACATGG + Intergenic
1133210856 16:4262738-4262760 CTGGAGATGAATGATGAAGAGGG - Intronic
1133249178 16:4469102-4469124 AGGCAGAGGCATGAAGAAGAGGG + Intronic
1133402099 16:5495785-5495807 ATGAAGATGCCTGGAGAAAAAGG - Intergenic
1134649573 16:15898111-15898133 AAGAAGATGAAAGAGGAGGAGGG - Intergenic
1134884189 16:17775395-17775417 AGGAAGATGAATGGGGAGGAGGG - Intergenic
1136496474 16:30648132-30648154 ATGCTGATGCATTAGCAAGAGGG - Intergenic
1137409970 16:48220101-48220123 ATGAAGATGTTTGAGGAAACTGG + Intronic
1138170300 16:54843293-54843315 ATGAAGATGAAAGTGAAAGAGGG + Intergenic
1140810062 16:78568266-78568288 ATGAAGATGAGGGAGGAAAATGG + Intronic
1141358395 16:83371282-83371304 CTGAAGATGCAGGAAGGAGAGGG - Intronic
1142318370 16:89364262-89364284 ATGAAGCTGCATTAGGCTGATGG - Intronic
1142343465 16:89538733-89538755 TTGGAGACGCATGTGGAAGACGG - Intronic
1143187503 17:5019555-5019577 TGCAAGATGCATGAGGCAGAGGG + Intronic
1144241260 17:13314870-13314892 AGGAAGATGAGTGAGGAAAAAGG + Intergenic
1145251331 17:21298411-21298433 AGGAAAATCCAAGAGGAAGAAGG + Exonic
1145271350 17:21406511-21406533 ATGATGAGGGATGGGGAAGAAGG + Intronic
1145309555 17:21693915-21693937 ATGATGAGGGATGGGGAAGAAGG + Intronic
1145406137 17:22596862-22596884 ATGAAAATACATGAGATAGAAGG + Intergenic
1148345526 17:46901088-46901110 AGGAAGATGTTTGAGGTAGAGGG + Intergenic
1148459880 17:47833370-47833392 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1148742954 17:49903090-49903112 ATGAAGATGCCAGAGGGAAAGGG - Intergenic
1149066435 17:52485983-52486005 AGGAAGACGAAAGAGGAAGATGG - Intergenic
1149959203 17:61088928-61088950 GTGTACATGCCTGAGGAAGATGG + Intronic
1150449151 17:65251388-65251410 ATGAAGATCCAGGAGGGAGTGGG + Intergenic
1150668828 17:67171523-67171545 ATGCAGATGAATTAGGAAGGAGG - Intronic
1150735530 17:67733845-67733867 ATTAAGATCCATGACCAAGAAGG - Intronic
1151257242 17:72887430-72887452 ATGCAGATGAAAGGGGAAGAAGG - Intronic
1152084061 17:78206649-78206671 AAGAAGATGAAGGAGGAAGGAGG - Intronic
1153778798 18:8476632-8476654 ATGAAGATGCATTTGGGGGAGGG + Intergenic
1154054559 18:11000561-11000583 ATGAAGATGCATTTAGAAGGAGG - Intronic
1154055139 18:11005606-11005628 GTGAAGGAGCTTGAGGAAGATGG - Intronic
1155836300 18:30589401-30589423 CTGAAGATGCCAGAGAAAGAAGG + Intergenic
1156269391 18:35517085-35517107 CTGGAGTTGCAGGAGGAAGATGG - Intergenic
1156595254 18:38541449-38541471 AGGAAGATGGAGGAGGAACATGG - Intergenic
1157198153 18:45636967-45636989 CTGAAGATGCAAGAGACAGAGGG - Intronic
1157265436 18:46215881-46215903 ATGAAGATGGAGGAGGCAGTGGG + Exonic
1157935010 18:51863287-51863309 ATGAAGATTAATGATGTAGAAGG - Intergenic
1158483369 18:57842773-57842795 ATGAAGATGCTCAGGGAAGAAGG - Intergenic
1158724063 18:59952246-59952268 AGGAAGATCCATGGGAAAGAGGG + Intergenic
1159181003 18:64904641-64904663 ATGAAGCACCATGAGGAACAAGG - Intergenic
1159364088 18:67443893-67443915 TTGGAGTTGCATGAGGAAGTGGG - Intergenic
1159698434 18:71591282-71591304 TTGAAGATGCTTGAGGTGGAAGG + Intergenic
1159939625 18:74396900-74396922 ATGAAAAAGCTTGAGGAAGCTGG - Intergenic
1160347870 18:78149716-78149738 ATGAATAAGCTTGAGGAAGGAGG - Intergenic
1162195120 19:8978747-8978769 ATGGAGATGGATGAGTCAGAGGG + Exonic
1162806211 19:13139202-13139224 ATGAAGATACAAGAGGCAGTAGG + Exonic
1163186720 19:15644159-15644181 ATGAAGATGGCTGAGAGAGAAGG - Intronic
1165451185 19:35884335-35884357 ATGAAGATGCAGTAAGAGGATGG - Intergenic
1166727879 19:45039619-45039641 ATGAAGATGCTAGAGGGAGTGGG - Intronic
1167205429 19:48098213-48098235 ATGAAGAAGCCCGTGGAAGAAGG - Exonic
1167627620 19:50603156-50603178 AAGAAGAGGAAGGAGGAAGATGG - Intergenic
925083182 2:1086010-1086032 ATTAAGATTCAGGAAGAAGAAGG + Intronic
925702126 2:6649227-6649249 ATGAAGAATGAGGAGGAAGAAGG - Intergenic
926266838 2:11330873-11330895 AGGAAGAGGAATGAGGAGGAGGG + Intronic
926316775 2:11715802-11715824 ATGAAAATGGAGGAGGAGGATGG + Intronic
926489071 2:13501423-13501445 AAGAATATTCATGAGGCAGAAGG - Intergenic
926525649 2:13976669-13976691 ATGTAGATAAATAAGGAAGAAGG + Intergenic
926525679 2:13977114-13977136 TTGATGATGCATGAGAGAGATGG + Intergenic
926592457 2:14754067-14754089 ATGATGATGTAGCAGGAAGAAGG - Intergenic
926874392 2:17458518-17458540 AGGAAGAAGCATTATGAAGATGG + Intergenic
927075623 2:19574095-19574117 ATGATGATGAATGAAGATGAAGG - Intergenic
928171798 2:29009212-29009234 ATGGAGATGGAGGTGGAAGAGGG + Intronic
929288515 2:40163465-40163487 AAGAGGGTGAATGAGGAAGAGGG + Intronic
929588134 2:43128679-43128701 GTGGAGAGGAATGAGGAAGAGGG + Intergenic
929651673 2:43686151-43686173 AGGAAGAAGGAAGAGGAAGAAGG - Intronic
930218184 2:48718937-48718959 ATGAACATGGCTGAGGTAGAAGG - Intronic
930253618 2:49064160-49064182 TTGAAAATGGATGAGGGAGAGGG + Intronic
930880217 2:56261917-56261939 AAGAAGGTGGTTGAGGAAGAGGG - Intronic
931094562 2:58924705-58924727 ATGAAGATGCAACTGGAAGCAGG - Intergenic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
934082578 2:88481881-88481903 GTGAAGCGTCATGAGGAAGAGGG - Intergenic
934482877 2:94669661-94669683 AGGTAGATGCATCAGGAGGAGGG - Intergenic
936046841 2:109195025-109195047 ATGAAAATGGAAGGGGAAGATGG + Intronic
936061950 2:109300650-109300672 ATGGAGAAGGAAGAGGAAGATGG - Intronic
936502959 2:113080972-113080994 AGGGAGAGGCATGTGGAAGAAGG - Intergenic
936517406 2:113191095-113191117 TTCCAGATGCATAAGGAAGATGG + Intronic
936659674 2:114528819-114528841 TTGATGATGAATCAGGAAGAAGG - Intronic
936695924 2:114948644-114948666 AGCAAGATCCCTGAGGAAGAAGG - Intronic
936741986 2:115523325-115523347 ATGAGGGTGGATGAGGATGAGGG + Intronic
937006189 2:118518236-118518258 ATGAATATGCATGACGATGGTGG - Intergenic
937624848 2:124032869-124032891 TAGAAGATGCATCAGGATGATGG - Intronic
938898421 2:135776270-135776292 AGGAAGAACCATCAGGAAGACGG - Exonic
939129719 2:138220220-138220242 ATGAAGAACCATGAGGTTGATGG + Intergenic
939727494 2:145740949-145740971 AGAAACATGCATGAGGAAAATGG + Intergenic
939797000 2:146657326-146657348 GTGAAGATGCAGCAAGAAGAAGG + Intergenic
940258509 2:151757332-151757354 GTGAGGATACAAGAGGAAGATGG + Intergenic
941216124 2:162711505-162711527 CTGAAAATGCAGGATGAAGATGG - Intronic
941530217 2:166660616-166660638 ATGAAGATGGAGAAGGAAGCAGG + Intergenic
941813935 2:169782006-169782028 ATGCTGATGCATGTGGAAGGTGG + Intergenic
944770809 2:202912475-202912497 AGGAGGAGGCAGGAGGAAGACGG - Intronic
944900992 2:204215984-204216006 AAGAAGATGGAGGAGGTAGAAGG - Intergenic
945276713 2:207995147-207995169 ATGAATCTGCAAAAGGAAGATGG - Intronic
945299911 2:208206493-208206515 AAGGAGATGGACGAGGAAGATGG + Intergenic
945823946 2:214697780-214697802 ACGAAGATGCAGGATAAAGAAGG + Intergenic
946097480 2:217287971-217287993 GTGAAGATACAAGAAGAAGATGG - Intronic
946620770 2:221560194-221560216 AGGAAGATGGATGAGGAAGTAGG + Intronic
946825888 2:223677451-223677473 ATGAAGATGCAACAAGAAGTTGG - Intergenic
948334594 2:237197570-237197592 ATGTAGATTCATGAGCATGAGGG + Intergenic
948875054 2:240821579-240821601 ATTAAAAAGCATGAGGAAAACGG - Intergenic
948883582 2:240872283-240872305 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883607 2:240872440-240872462 GTGAACATGCAGGAGGAGGAGGG + Intronic
1169339172 20:4783054-4783076 GTGAAGGTGCATGGGGAGGATGG - Exonic
1169348578 20:4850010-4850032 ATGAAGATGCAGTAGGAGAAGGG + Intergenic
1169554743 20:6737232-6737254 ATGGAGATGTGGGAGGAAGAAGG + Intergenic
1170098089 20:12669112-12669134 ATGGAGATGCATGAGTTACAGGG - Intergenic
1170740842 20:19054649-19054671 CTGAAGATGCCTGAGGAAAATGG + Intergenic
1171189378 20:23148172-23148194 ATGAAGAGGCCTGAGCAGGAAGG + Intergenic
1172441283 20:34968432-34968454 TTGAAGCTCCGTGAGGAAGAGGG + Intergenic
1172834930 20:37867275-37867297 TTAAAAATGCAGGAGGAAGAGGG - Intronic
1172886398 20:38234008-38234030 ATGAAGATACAGGGAGAAGATGG + Intronic
1173056688 20:39621478-39621500 AAGAAGAAGGAGGAGGAAGAGGG - Intergenic
1173496738 20:43524810-43524832 ATGGAAATGCATGATGAAGCTGG + Intronic
1173615813 20:44402344-44402366 ATAAAGATGCAGGAAGAACAGGG - Intronic
1174673816 20:52333891-52333913 AAGAAGATGCAGGAGCAAGAAGG + Intergenic
1174857213 20:54057767-54057789 ATGAAGATGCAGGGAGGAGATGG + Intronic
1174866174 20:54137811-54137833 ATGAAAATGGAAGAGAAAGAAGG - Intergenic
1177208857 21:18044959-18044981 ATGCAGATGCATGTGGGTGAGGG + Intronic
1179182155 21:39054698-39054720 CTGAAGATGGGAGAGGAAGAAGG - Intergenic
1179195862 21:39161736-39161758 ATGAAGATGCAGGAAGGAGAGGG + Intergenic
1179339123 21:40487754-40487776 ATGAAGCTGCTTGAGGGTGAGGG + Intronic
1180950891 22:19720027-19720049 ACCAAGATGGATGAGGACGAGGG + Intronic
1181508458 22:23377637-23377659 ATGAAGAAGGAAGAGAAAGAAGG + Intergenic
1182053930 22:27334870-27334892 ATGCAGATTCATGATGAAGATGG + Intergenic
1182679871 22:32070285-32070307 AAGAAGAAGAATGAAGAAGAAGG - Intronic
1183372454 22:37441552-37441574 ATGAAAATGCAGGAGAAAGAGGG - Intergenic
1184014794 22:41777892-41777914 AAGAAGATGAAGGAGAAAGAAGG - Intronic
949798382 3:7876620-7876642 ATGAAGATGCATGGGGTGGTGGG + Intergenic
949877262 3:8634441-8634463 ATGAAGATGCAAGGGGAGGAAGG - Intronic
950232891 3:11292135-11292157 ATGAAGTTGCATGAGGAGCATGG + Intronic
950352470 3:12369940-12369962 GAGAAAATGCAGGAGGAAGAAGG - Intronic
950528277 3:13537304-13537326 ATGCAGATGGATGACGAACATGG + Intergenic
950704877 3:14773442-14773464 AAGAAGATGGAGGAGGGAGAAGG + Intergenic
951033822 3:17911101-17911123 AGGAAGAAGCAAGAGGAAGAAGG - Intronic
951545556 3:23821505-23821527 AGGAAGATGCTAGTGGAAGAAGG + Intronic
951799444 3:26578893-26578915 ATGAATATAAATGGGGAAGAGGG - Intergenic
952521854 3:34168736-34168758 ATTAAAAGGCATGAGGAAAAGGG + Intergenic
953017438 3:39091660-39091682 CTGAAGATGCATGAGGTTGGAGG - Exonic
953435267 3:42872790-42872812 ATGAAGGTGAAAGAGGAGGAGGG + Exonic
953597993 3:44336353-44336375 ATCAATATCCATGAGGAAAATGG + Intergenic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
953798755 3:46005373-46005395 ATGAAACTGCATGAGGAAAACGG + Intergenic
955821700 3:62902665-62902687 ATGAAGATCAATAATGAAGAAGG - Intergenic
956188697 3:66587104-66587126 ATGATAATCCATGAGGGAGAGGG - Intergenic
956359376 3:68430364-68430386 ATGAAATTGCATGAGACAGAAGG + Intronic
956834663 3:73086819-73086841 ATTAAGAGCCATGAGGAGGAAGG + Intergenic
957145851 3:76422935-76422957 CTAAAGATGCATGATGAAAAGGG + Intronic
957968133 3:87347190-87347212 AAAAAGATGCATGATGTAGATGG - Intergenic
958639514 3:96787021-96787043 ATTGGGATGCATGAGGCAGAAGG - Intergenic
959393962 3:105812672-105812694 ATGAAGATACAAAAGTAAGAAGG + Intronic
959906952 3:111720973-111720995 ATGATGAAGTAAGAGGAAGATGG + Intronic
961868220 3:129969565-129969587 AGGGAGATGCAAGAGAAAGATGG - Intergenic
962365801 3:134779557-134779579 ATGAACATCCATGTGTAAGATGG - Intronic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
962914671 3:139888981-139889003 ATGTAGATAAATGATGAAGAAGG - Intergenic
964236450 3:154535971-154535993 AAGAAGATAAAGGAGGAAGAGGG - Intergenic
964419144 3:156482953-156482975 ATTAAGATGCATGAGTCACATGG + Intronic
964810401 3:160657273-160657295 ATGAAGTTGCATGGAGAAGGGGG - Intergenic
964963605 3:162460714-162460736 AGGAAGAAGCATGAGAAAAAAGG + Intergenic
965017874 3:163182830-163182852 ATGAAGATGATGAAGGAAGAAGG - Intergenic
965171724 3:165274460-165274482 GTGGAGATGCATGAGGAAGTTGG - Intergenic
965238362 3:166158035-166158057 ATGAAGATACAAGGAGAAGATGG + Intergenic
965246949 3:166284805-166284827 ATGAAGATGTTAGGGGAAGAAGG + Intergenic
965613161 3:170565814-170565836 ATGAAGAAACAAGTGGAAGAGGG + Intronic
966238146 3:177725743-177725765 ATAAAGAGACATGAGGAGGATGG + Intergenic
966413806 3:179669109-179669131 ATGTAGAGGCATGTGGAAAAGGG - Intronic
966934202 3:184695141-184695163 ATGGAGATGCTTGAGGAAGATGG - Intergenic
967266947 3:187699446-187699468 AGCAAGATGCATGAGTTAGATGG - Intronic
967666082 3:192173823-192173845 ATGTACATTCATAAGGAAGAAGG - Intronic
968196047 3:196707375-196707397 ATGTAGGTGCATGAGGAGTATGG - Exonic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969437797 4:7198769-7198791 ATGAAGAACCATGAGGGAGCCGG + Intronic
970291121 4:14573375-14573397 GTGAAGACACAGGAGGAAGATGG + Intergenic
970709617 4:18846598-18846620 GTGAAATTGCATTAGGAAGAGGG - Intergenic
970859915 4:20690272-20690294 ATGACGATGCAAGAGGAACCTGG - Intergenic
971146002 4:23976972-23976994 AGGAAGAAGGAGGAGGAAGAGGG + Intergenic
971878316 4:32333668-32333690 ATGAAGATGAGTTGGGAAGAGGG - Intergenic
971997402 4:33982661-33982683 ATGAAAATACATGAGATAGATGG - Intergenic
972749110 4:41970944-41970966 ATGAGTGTGCATGAGGCAGAGGG - Intergenic
972922576 4:43962182-43962204 ATGCAGGTGCATGATGAAGATGG + Intergenic
972944283 4:44234984-44235006 ATGAAGAATCATTAGGCAGAAGG + Intronic
973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG + Intronic
973228135 4:47809993-47810015 AGGAAGGTGCTTGTGGAAGAGGG - Intronic
974667725 4:64986815-64986837 CTGAACTTGGATGAGGAAGAGGG - Intergenic
975407970 4:74013824-74013846 ATCAAGATACATGACGAACAGGG - Intergenic
975436220 4:74355143-74355165 ATGAAGAGGGACCAGGAAGAAGG + Intergenic
975911037 4:79267132-79267154 ATGAATTTGCTTCAGGAAGAAGG - Intronic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976182153 4:82408896-82408918 ATGAAGCTGAATGATGAAAAAGG - Intergenic
977441290 4:97071033-97071055 ATGAAGATACAGGGAGAAGATGG + Intergenic
977445967 4:97132541-97132563 AGGAAGATGTATGATAAAGAAGG - Intergenic
978004033 4:103594723-103594745 ATTAAAATGCATGTGGAAAATGG + Intronic
978235815 4:106458543-106458565 AGGAAGAAGAAGGAGGAAGAAGG + Intergenic
978422100 4:108543739-108543761 ATGAACATAAATGAGGAAGGAGG + Intergenic
978499555 4:109394209-109394231 ATGTAGGTGCTTGAGGTAGAAGG + Intergenic
978686848 4:111455427-111455449 AAGAAGATGCAGCTGGAAGATGG + Intergenic
979823879 4:125208689-125208711 ATGAAGAAGTATAAGAAAGAGGG + Intergenic
979932605 4:126650419-126650441 ATGAACATGCATGAATAAAAAGG + Intergenic
980190694 4:129520552-129520574 AAGAAGAAGAAGGAGGAAGAGGG + Intergenic
980742568 4:136972046-136972068 AAGAAGAAGGATGAAGAAGAAGG + Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981453242 4:144923517-144923539 ATCAAGAATCATGTGGAAGATGG - Intergenic
981508225 4:145526668-145526690 CTGAAGATGAATGGGGGAGAAGG + Intronic
981932495 4:150206015-150206037 GTGAAGATGGACTAGGAAGACGG - Intronic
982786427 4:159542595-159542617 ATGTTGAAGCATGAGGAAAATGG + Intergenic
982893751 4:160890200-160890222 ATGCAGAAGCAAGAGAAAGAAGG + Intergenic
983080385 4:163377943-163377965 AAGTAGATGAATGAAGAAGAGGG - Intergenic
984588853 4:181594188-181594210 ATGAATAAGCATGATGAATAAGG + Intergenic
984994715 4:185418461-185418483 AAGAAAATTCATGAGAAAGAAGG - Exonic
985067484 4:186137383-186137405 ATGAATGTGCATGAGGGACAGGG - Intronic
985773541 5:1827798-1827820 ATGAAGTGGTATGAGGAGGAGGG + Intergenic
985944632 5:3168443-3168465 ATGAAGATACAGCAAGAAGATGG + Intergenic
986097000 5:4567831-4567853 ATGAGCATGCATGGGGAAAAGGG + Intergenic
986102296 5:4625100-4625122 ATGGAGATGGATGATGATGATGG + Intergenic
986611459 5:9572207-9572229 ATGAAGATGTATGGCCAAGAGGG + Intergenic
986672396 5:10154061-10154083 ATAAAAATGCATGTGGCAGAAGG + Intergenic
987322450 5:16783132-16783154 ATGAAGGGGCAGGAGGCAGAAGG + Intronic
987468165 5:18296769-18296791 ATTAATTTACATGAGGAAGAGGG - Intergenic
987866691 5:23549920-23549942 ATGATCAACCATGAGGAAGAGGG - Intergenic
987867539 5:23564687-23564709 ATGGAAAGGCATGAGGGAGAAGG - Intergenic
987961470 5:24814585-24814607 CTGAATTTGGATGAGGAAGAGGG + Intergenic
988806244 5:34743377-34743399 ATGCAGAGACATGAGGAAGAAGG - Intronic
990474114 5:56144922-56144944 ATGAAGATGCCTGATAAAGGGGG + Intronic
991126163 5:63072073-63072095 AGAAAGATGCATTATGAAGATGG - Intergenic
991410124 5:66337501-66337523 ATGAAGATGCAAGAGTATGCAGG - Intergenic
991524142 5:67537618-67537640 ATGAAGGGGCAGGAGGCAGACGG + Intergenic
992090684 5:73313135-73313157 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
992630155 5:78671993-78672015 AGGCAGATGCACGAGGAAGGAGG + Intronic
993223289 5:85131936-85131958 ATGCAGATGCAGGGGGAAGAAGG - Intergenic
993543931 5:89187536-89187558 ATGAAGAAGAATGAGATAGAGGG - Intergenic
993787625 5:92163539-92163561 ATTAAGCTGCATTAGGATGATGG + Intergenic
993885170 5:93407597-93407619 AAGAAGATGCATGTGGCAGGAGG - Intergenic
994890411 5:105626517-105626539 ATTAAGAAGCCAGAGGAAGATGG - Intergenic
995420097 5:111955000-111955022 ATGAAGATGCATGAGGAAGAAGG + Intronic
995466270 5:112452230-112452252 TTGAAGCTGTAGGAGGAAGATGG - Intergenic
995538688 5:113163115-113163137 ATGAGGACCCATGAGGCAGAGGG - Intronic
995554921 5:113317780-113317802 ATGAAGATGCAAATGGAAAAAGG + Intronic
995708211 5:115007433-115007455 CTAAAGAGGCATGTGGAAGATGG + Intergenic
996800713 5:127399778-127399800 ATGAAGAAGTATGCAGAAGAAGG - Intronic
997206771 5:132054778-132054800 AGGAAGAAGGATGAGGAGGAGGG + Intergenic
997262307 5:132474612-132474634 ATGAAGAAGGAGGAGGCAGAAGG - Intronic
997672555 5:135687991-135688013 CTGAAGATGGATGGGGGAGATGG - Intergenic
998361190 5:141589191-141589213 AAGAATAAGCATGAGAAAGAAGG + Intronic
998520803 5:142798755-142798777 AAGGAGAAGCATGGGGAAGAGGG - Intronic
999349608 5:150856787-150856809 ATGTATATGGATGAGGAAGAGGG - Intronic
999700602 5:154224409-154224431 ATACAGATGGACGAGGAAGAAGG - Intronic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1001972837 5:175970266-175970288 ATGAAGATTCCTGAAAAAGAGGG - Intronic
1002244601 5:177873516-177873538 ATGAAGATTCCTGAAAAAGAGGG + Intergenic
1002992665 6:2252195-2252217 ATGAAAATGAATGAGAGAGAAGG + Intergenic
1003395747 6:5750578-5750600 TTGCAGGTGCAGGAGGAAGAAGG + Intronic
1003955980 6:11165317-11165339 AGGAAGGTGCAGCAGGAAGAAGG - Intergenic
1003989977 6:11476610-11476632 GTGGAGATGGATGAGGCAGATGG + Intergenic
1004029298 6:11850575-11850597 ATGAAGATCCAGGAGGCACATGG + Intergenic
1004129311 6:12903643-12903665 ATTAAGAAGCATGAGTAAAATGG + Intronic
1004266453 6:14152085-14152107 AGGAAGAAGGAAGAGGAAGAAGG - Intergenic
1004919714 6:20365096-20365118 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1004991924 6:21147738-21147760 ATGAAGCAACGTGAGGAAGAAGG + Intronic
1005496697 6:26393578-26393600 ATGAAGATGAATGAAGAACATGG + Exonic
1005501427 6:26431949-26431971 ACGAAGATGAATGAAGAATATGG + Intergenic
1005505998 6:26469160-26469182 ATGAAGATGAATGAAGAACATGG + Exonic
1005605986 6:27477914-27477936 AAGTAGATAAATGAGGAAGAGGG - Intergenic
1006027401 6:31156205-31156227 AAGAAGCAGCATGATGAAGAAGG - Intronic
1006220872 6:32490165-32490187 ATCATGATGAATGAGGAACAGGG - Intergenic
1007321255 6:41030376-41030398 ATGAAGATCCGGTAGGAAGAGGG - Exonic
1007714514 6:43848026-43848048 ATGAAGAAGGAGGAGGAAGGTGG + Intergenic
1007813999 6:44507243-44507265 ATGATGATGAAAGAGGAAGAGGG + Intergenic
1008779781 6:55089650-55089672 AAGAGGATGGAGGAGGAAGAAGG - Intergenic
1008899853 6:56599285-56599307 ATGAAAATGCATGATAAAGGAGG - Intronic
1009599394 6:65778905-65778927 ATTAAGCAGAATGAGGAAGATGG - Intergenic
1009641586 6:66344204-66344226 ATGCTGAAGCATGAGGGAGAGGG + Intergenic
1009659081 6:66586739-66586761 ATAAATATCAATGAGGAAGATGG + Intergenic
1010311381 6:74389870-74389892 AAGAAGAGGAAGGAGGAAGAAGG - Intergenic
1010803229 6:80202301-80202323 CTGAAGATGCAGGAGAGAGATGG - Intronic
1011002979 6:82611889-82611911 ATGAACTGGCATGTGGAAGAAGG - Intergenic
1011066443 6:83331645-83331667 ATGAAGACACCAGAGGAAGACGG + Intronic
1012257180 6:97047651-97047673 TAGAAGAGGTATGAGGAAGAAGG + Intronic
1012297938 6:97547822-97547844 GTGAAGATACAAGAAGAAGATGG - Intergenic
1013038905 6:106414297-106414319 AAGAAGCTGCACAAGGAAGATGG + Intergenic
1013732911 6:113190165-113190187 AGGAAGAAGGCTGAGGAAGATGG - Intergenic
1013740313 6:113276067-113276089 ATGTGGCTACATGAGGAAGACGG + Intergenic
1013811556 6:114050140-114050162 ATGAAGGTGGAGGAGGAAGGAGG - Intergenic
1014571136 6:123009527-123009549 GTGAAGATATATGAGGAAGTAGG - Intronic
1014949588 6:127539107-127539129 ATGCAGATGCTGGAGGAAGCAGG - Intronic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015034108 6:128631667-128631689 ATGAAGATGTTTGAGAAATAAGG + Intergenic
1015225509 6:130852776-130852798 ATGGAGATGCAGGAGGAAGGAGG - Intronic
1015812700 6:137177326-137177348 AGGAACATGGATGTGGAAGAAGG - Intergenic
1016316116 6:142789075-142789097 ATGAGGATGCTTGGGGAATAAGG + Intronic
1016332167 6:142964880-142964902 GTGAGGATGGATGAGGAAGGGGG - Intergenic
1017484914 6:154893617-154893639 CTGCAGATGCATGTGGAAGTTGG + Intronic
1018729634 6:166638973-166638995 ATGAAGAGGGAGGAAGAAGAGGG + Intronic
1018898167 6:168035571-168035593 GGGAAGATCCATCAGGAAGATGG + Intronic
1019049293 6:169170755-169170777 CTGAAGATGCATGAGGATGAGGG + Intergenic
1019229209 6:170544007-170544029 ATGAAGTGGCCTAAGGAAGATGG + Intronic
1021587365 7:22223581-22223603 TTGATGATGCAGGAGGGAGAAGG + Intronic
1022104455 7:27188272-27188294 GTGAAGATGGATGAGGGAAAAGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022910850 7:34898611-34898633 GTGAATAGGCATGAGGAACAGGG - Intergenic
1023639909 7:42247095-42247117 GTTTAGATGCAGGAGGAAGAAGG + Intergenic
1023738475 7:43255828-43255850 ATGAGCATGCATGAGGGAGGAGG + Intronic
1023872972 7:44272637-44272659 ATGAACATGCATGACGGAGCTGG + Intronic
1024087737 7:45910521-45910543 CAGAAGTTGCCTGAGGAAGATGG + Intergenic
1025171670 7:56763829-56763851 ATGAAGAATCATGAGAGAGAGGG + Intergenic
1025700195 7:63811719-63811741 ATGAAGAATCATGAGAGAGAGGG - Intergenic
1026250391 7:68664938-68664960 ATGTTGATCTATGAGGAAGAAGG + Intergenic
1027363393 7:77432268-77432290 ATGAAGACCCATGAGGTACATGG - Intergenic
1027960256 7:84937223-84937245 AAGAAGAAGCAATAGGAAGAAGG + Intergenic
1027968565 7:85045807-85045829 ATCAAGAGCCATGAGAAAGATGG - Intronic
1029536067 7:101158581-101158603 GGAAAGATGCAAGAGGAAGAGGG + Intronic
1030359231 7:108578044-108578066 GAGAAGATCTATGAGGAAGAGGG + Intergenic
1030509040 7:110460483-110460505 AAGAAGATGGAAGAGGAGGAGGG + Intergenic
1031177768 7:118374421-118374443 AAGAAGATGAAAGAGGGAGATGG + Intergenic
1031314961 7:120245050-120245072 ATCCAGAAGCATGAGGGAGATGG + Intergenic
1031587999 7:123555998-123556020 ATGATGGTGACTGAGGAAGAGGG + Intronic
1031626992 7:124003591-124003613 ATCAAGATTCAGGAGGAGGATGG - Intergenic
1032466805 7:132151292-132151314 AAGAAGAAGGAGGAGGAAGAAGG + Intronic
1033617293 7:143029002-143029024 ATGAAGAAACATGAGCGAGAAGG + Intergenic
1035108694 7:156462767-156462789 GTGAAGATTCAAGAGTAAGATGG + Intergenic
1035245903 7:157561817-157561839 AGGAAGATGCAGCAGGAGGATGG + Intronic
1035260700 7:157659586-157659608 CTGAAGATGTATGGGAAAGAAGG - Intronic
1035644016 8:1204719-1204741 ATGGAGATGGATGAGGCAGTAGG + Intergenic
1036105365 8:5832311-5832333 ATGAATATGAATGAACAAGAAGG + Intergenic
1036114421 8:5943355-5943377 ATGAAGATGCAGGAAGAAGGTGG - Intergenic
1038329643 8:26597928-26597950 ATGAAGATGCATCATCAAGAAGG - Intronic
1038902462 8:31858897-31858919 ATCAAGATGCTTGAGGAAGTGGG - Intronic
1039937276 8:42056612-42056634 CTGAAGATGCATGAGACAGAAGG - Intergenic
1040601100 8:48884561-48884583 ATGAAGATACATAAGAAACAGGG + Intergenic
1041109884 8:54474164-54474186 GTGGAAATGCATGAGGAAGCGGG - Intergenic
1041326050 8:56665811-56665833 GTGTAGATGAATGATGAAGAGGG + Intergenic
1041441776 8:57904792-57904814 GGGAAGAAGCAAGAGGAAGAGGG + Intergenic
1041969443 8:63720617-63720639 TTGAAGATGCATGAGGGAGAAGG + Intergenic
1042398185 8:68315173-68315195 ATGAATAAATATGAGGAAGAAGG - Intronic
1042953742 8:74226549-74226571 AAGAATAAGCATGGGGAAGATGG + Intergenic
1043178277 8:77049519-77049541 ATTAATATTCATGAGTAAGATGG - Intergenic
1044618115 8:94163122-94163144 ATGAAGATGAATGAGTAACTCGG - Intronic
1044704670 8:94996847-94996869 ATGAAGACGCAGGGAGAAGATGG + Intronic
1044822293 8:96162436-96162458 ATGAAAAAGCAAAAGGAAGAAGG - Intergenic
1048236339 8:132694400-132694422 GTGAAGATGCAGGGAGAAGATGG + Intronic
1048320229 8:133393808-133393830 ATAAAGTTGGATGAGGAAGAGGG + Intergenic
1049236793 8:141516164-141516186 ATCATGATGCAGGAGAAAGAGGG - Intronic
1049320055 8:141991505-141991527 ATGAAGGTGCCTCAGGTAGAGGG - Intergenic
1049654779 8:143792707-143792729 CGGAAGATGCAGGAGGAGGAAGG - Exonic
1049733292 8:144190144-144190166 ATGCAGAGGCAGGAGGAAGATGG - Intronic
1050153051 9:2636460-2636482 ATAATGATGCATGAAGAAGTAGG - Intronic
1050266467 9:3895692-3895714 ATGAAGATGAACAGGGAAGATGG - Intronic
1050478452 9:6064883-6064905 CTGAAGGGGCATGAGGAAGGTGG + Intergenic
1050930400 9:11315687-11315709 ATGAAGATACAACAAGAAGATGG + Intergenic
1051145441 9:14022487-14022509 ATGAACATGCATGAGGTGGCTGG - Intergenic
1051146766 9:14035154-14035176 GTGAAAATGTATGAGGATGAGGG + Intergenic
1051923106 9:22290967-22290989 ATGAAGATAGAGAAGGAAGAAGG + Intergenic
1053674953 9:40415060-40415082 AGGTAGATGCATCAGGAGGAGGG + Intergenic
1053924745 9:43041419-43041441 AGGTAGATGCATCAGGAGGAGGG + Intergenic
1054288229 9:63253592-63253614 AGGTAGATGCATCAGGAGGAGGG + Intergenic
1054386055 9:64555127-64555149 AGGTAGATGCATCAGGAGGAGGG + Intergenic
1054509666 9:65961233-65961255 AGGTAGATGCATCAGGAGGAGGG - Intergenic
1055101678 9:72472028-72472050 ATGGGGATGGATGAGGATGAGGG + Intergenic
1055235048 9:74111371-74111393 AGCAAGATGCATGAGGATGGTGG - Intergenic
1055486775 9:76763796-76763818 ATGGGGAAGCATGGGGAAGAGGG + Intronic
1055904907 9:81281902-81281924 ATGAAGATGCATCATGAAGAAGG - Intergenic
1056515761 9:87347823-87347845 GGGAAGATACATGAAGAAGATGG - Intergenic
1059073074 9:111160027-111160049 TTGAAGATGCAGGAGAGAGAGGG - Intergenic
1062731374 9:138112065-138112087 ATGAGGATTTAGGAGGAAGATGG - Intronic
1185689146 X:2138937-2138959 GTGAAGATACAGTAGGAAGAAGG + Intergenic
1187322538 X:18253050-18253072 GTGATAATACATGAGGAAGAAGG + Intronic
1187481522 X:19660302-19660324 ATAAAGAAGCATTATGAAGATGG - Intronic
1187661913 X:21556930-21556952 TTGATGATGCAGGAGAAAGAAGG + Intronic
1188459346 X:30405440-30405462 ATGAAGATACAGGAAGAAGGTGG - Intergenic
1189115822 X:38341596-38341618 ATGAAGATGCATAATAAAAATGG - Intronic
1189186648 X:39060748-39060770 ATGAAGAAGAATGAGGTACATGG + Intergenic
1191694406 X:63975061-63975083 ATGAAGATGCAAAAGGGTGAAGG + Intergenic
1191885639 X:65885042-65885064 CTGAGGATGCAGCAGGAAGATGG + Intergenic
1192612586 X:72582280-72582302 AAAAAGAAGTATGAGGAAGAGGG + Intronic
1194474676 X:94344046-94344068 AAGAAGATGTTAGAGGAAGAAGG + Intergenic
1194621986 X:96184229-96184251 ATAAAAATGAATGAGGAAGGTGG - Intergenic
1194988801 X:100522007-100522029 AAGAAGGTGGATGAGGAAGAAGG - Intergenic
1196230950 X:113220503-113220525 ATGCAAATACAAGAGGAAGAAGG + Intergenic
1196256346 X:113523645-113523667 ATGAACATGCATGGGAAAAAAGG - Intergenic
1198035040 X:132793499-132793521 ATAAAGATACAGGAGGAAGATGG - Intronic
1198039898 X:132840275-132840297 ATTTAGTTGCATGAGGTAGAGGG + Intronic
1198388542 X:136150345-136150367 AAGGAGAGGCATGGGGAAGAAGG - Intronic
1198463591 X:136885163-136885185 TAGAAGATCCATGAGGAGGAGGG - Intergenic
1198518648 X:137431078-137431100 AGGAAGATCCAGGAGGAAGAAGG - Intergenic
1201550342 Y:15211622-15211644 AAGAAGGTGCAAGAGGGAGAGGG + Intergenic