ID: 995420122

View in Genome Browser
Species Human (GRCh38)
Location 5:111955402-111955424
Sequence ATCTAACACCTATAGATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995420122_995420126 12 Left 995420122 5:111955402-111955424 CCTTGTATCTATAGGTGTTAGAT 0: 1
1: 0
2: 0
3: 8
4: 143
Right 995420126 5:111955437-111955459 TTTGGCCATAAACTACACAGGGG 0: 1
1: 0
2: 0
3: 10
4: 142
995420122_995420123 -6 Left 995420122 5:111955402-111955424 CCTTGTATCTATAGGTGTTAGAT 0: 1
1: 0
2: 0
3: 8
4: 143
Right 995420123 5:111955419-111955441 TTAGATGTGAACAACAAATTTGG No data
995420122_995420127 13 Left 995420122 5:111955402-111955424 CCTTGTATCTATAGGTGTTAGAT 0: 1
1: 0
2: 0
3: 8
4: 143
Right 995420127 5:111955438-111955460 TTGGCCATAAACTACACAGGGGG No data
995420122_995420125 11 Left 995420122 5:111955402-111955424 CCTTGTATCTATAGGTGTTAGAT 0: 1
1: 0
2: 0
3: 8
4: 143
Right 995420125 5:111955436-111955458 ATTTGGCCATAAACTACACAGGG 0: 1
1: 0
2: 0
3: 13
4: 161
995420122_995420124 10 Left 995420122 5:111955402-111955424 CCTTGTATCTATAGGTGTTAGAT 0: 1
1: 0
2: 0
3: 8
4: 143
Right 995420124 5:111955435-111955457 AATTTGGCCATAAACTACACAGG 0: 1
1: 0
2: 0
3: 8
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995420122 Original CRISPR ATCTAACACCTATAGATACA AGG (reversed) Intronic
900914728 1:5628519-5628541 ATCTAAGCCCTATAAAAACAGGG + Intergenic
901147915 1:7080145-7080167 AAGTAATACCTATAGATTCATGG + Intronic
902895333 1:19475856-19475878 ATCTAACACCTGTAGAGCAATGG + Intronic
908709368 1:66997632-66997654 ATTTAACCCCTTTAGATATAGGG - Intergenic
908818757 1:68060359-68060381 ATCTAACACATTTACATTCAAGG - Intergenic
908949317 1:69540410-69540432 AAGGAACACCCATAGATACAGGG + Intergenic
911908082 1:103594826-103594848 AACTAGCACCTCCAGATACATGG - Intergenic
911913616 1:103667307-103667329 AACTAGCACCTCCAGATACATGG - Intronic
911914836 1:103684640-103684662 AACTAGCACCTCCAGATACATGG + Intronic
912040759 1:105387029-105387051 GTCTAACACTTACACATACATGG - Intergenic
915382637 1:155456196-155456218 ATCTAAAACCTGAAAATACATGG - Intronic
916702994 1:167317540-167317562 ATCTATAATCTATAGAAACAAGG - Intronic
1063352134 10:5365465-5365487 ATCTAACACCTTTGGAAAGAGGG - Intronic
1068092172 10:52445792-52445814 AACCAACACCTATTGTTACAAGG - Intergenic
1068276364 10:54803910-54803932 ATCTATCAACTATAGAAAAATGG + Intronic
1068545910 10:58345496-58345518 ATCAAACACCTTCTGATACAAGG + Intronic
1071518000 10:86311919-86311941 ATCTCAGACCTATAGATCAAGGG - Intronic
1072205429 10:93200176-93200198 ACCTAACAACTAAAGATGCAGGG + Intergenic
1073575755 10:104621839-104621861 ATCTAACAACTATTTACACAGGG + Intergenic
1077959618 11:7061176-7061198 ATGTGACACCTATAAACACAAGG + Intronic
1079630905 11:22673868-22673890 ATCTTACATCTATAAAAACAAGG - Intronic
1080129210 11:28773675-28773697 AGTTAACTCCTATAGATCCAAGG - Intergenic
1080310883 11:30890345-30890367 TTCCAACACCTATATTTACATGG + Intronic
1080651455 11:34225889-34225911 TTCTAAAACCTATAGTTACTTGG - Intronic
1082682766 11:56197862-56197884 TTCTAACCCTTATAGGTACAGGG + Intergenic
1083354503 11:62056143-62056165 ATCTAGCACCTATTGTTCCAAGG - Intergenic
1084084384 11:66848275-66848297 ATTTAACACCTATTAACACAGGG - Intronic
1084875286 11:72127200-72127222 ATTTAACACATTTAGTTACATGG - Intronic
1085558275 11:77445728-77445750 ATCTATCACATATAGAATCATGG + Intronic
1086023914 11:82267159-82267181 AACAAATACCTATAGATCCACGG - Intergenic
1087136756 11:94728938-94728960 ATCTGAAAGCTATACATACAAGG + Intronic
1088148212 11:106711206-106711228 ATCTAGCACCTACATATGCATGG - Intronic
1088171131 11:106998003-106998025 TTTTAACACCTAAAGATACAAGG - Intronic
1092947365 12:13469258-13469280 ATTTAAGACCTATAAATAGATGG - Intergenic
1093110163 12:15142363-15142385 ATCTAACAGCTATACAAACATGG + Intronic
1093759820 12:22896459-22896481 TTCAAACACCTAGAGCTACAGGG + Intergenic
1094252649 12:28382557-28382579 ATCTAATACATAGAGAAACATGG + Intronic
1096431219 12:51544750-51544772 ATATAACACATACATATACATGG - Intergenic
1101726747 12:107394306-107394328 AACTAAGAACTATAGAGACATGG + Intronic
1108865724 13:54920068-54920090 ATCTATAATCTATAGAAACAAGG - Intergenic
1108949118 13:56064955-56064977 ATTTAACAACTATACACACAGGG - Intergenic
1109739241 13:66530035-66530057 ATGTAACAACTATATATGCAGGG - Intronic
1110620569 13:77590216-77590238 TTTTAACACCTATTGCTACATGG - Intronic
1110935880 13:81288032-81288054 ATTTAACACTTATGGAGACATGG + Intergenic
1111009256 13:82290749-82290771 ACATAACACCTATAAATACTCGG + Intergenic
1111394652 13:87649430-87649452 ACATAAAGCCTATAGATACATGG - Intergenic
1111599611 13:90455689-90455711 ATATGACACCTACAGAAACATGG + Intergenic
1112668458 13:101606053-101606075 ATATATCACATATATATACAAGG - Intronic
1113142649 13:107171773-107171795 TTCTAACACCCATGGATAAATGG - Intronic
1114976389 14:28105808-28105830 ATCTGACAACTAAAGAGACAAGG - Intergenic
1116514729 14:45791357-45791379 ATTTAACATGTTTAGATACAAGG + Intergenic
1124104884 15:26728498-26728520 ATCTAACTACAATAGATACTGGG + Intronic
1126311708 15:47324969-47324991 ATCAAATACCAATATATACATGG - Intronic
1127423297 15:58829980-58830002 ATCTGAGAGATATAGATACAGGG - Intronic
1128888523 15:71310414-71310436 AACGAAGACCTAAAGATACAGGG + Intronic
1138879690 16:60996259-60996281 TTCTAACATATATAAATACAAGG + Intergenic
1149224757 17:54456599-54456621 ATTTAACACATTAAGATACATGG + Intergenic
1149368617 17:55970510-55970532 ATCTAACAGATATGGATTCAAGG - Intergenic
1150357556 17:64500234-64500256 ATTTAATACCTTTAGAGACAGGG - Exonic
1156749825 18:40438521-40438543 ATCTACCTCCTCTAGAAACAAGG + Intergenic
1159339933 18:67121506-67121528 ATGTAATACCCATAGATACCAGG + Intergenic
1160283375 18:77515148-77515170 ATATAAAACCTATAGAGAAAAGG - Intergenic
926681630 2:15668416-15668438 ATCTAACAACTCTAGTTACTGGG + Intergenic
927117871 2:19923061-19923083 ATCAAATATCTATAGAAACAAGG + Intronic
927118489 2:19928313-19928335 ATCGAATATCTATAGAAACAAGG + Intronic
928775357 2:34754663-34754685 ATATAAAATCTATAGATAGAGGG - Intergenic
930629624 2:53737927-53737949 ATTTAAAACCTAAAGAAACAGGG + Intronic
931159872 2:59677176-59677198 AACAAAAACCTATGGATACAAGG + Intergenic
931465259 2:62480707-62480729 ATCTACTGGCTATAGATACATGG + Intergenic
933123921 2:78578922-78578944 AAGTAACACACATAGATACAAGG - Intergenic
933916883 2:87004085-87004107 ATCTAAAACCAATAGATTTATGG - Intronic
934006112 2:87765829-87765851 ATCTAAAACCAATAGATTTATGG + Intronic
935769714 2:106406098-106406120 ATCTAAAACCAATAGATTTATGG + Intronic
935910378 2:107889822-107889844 ATCTAAAACCAATAGATTTATGG - Intronic
935968502 2:108506665-108506687 ATCTAAAACCAATAGATTTATGG - Intronic
936132172 2:109854965-109854987 ATCTAAAACCAATAGATTTATGG - Intronic
936212525 2:110516520-110516542 ATCTAAAACCAATAGATTTATGG + Intronic
936421663 2:112371099-112371121 ATCTAAAACCAATAGATTTATGG + Intronic
936865187 2:117069646-117069668 ATCTAACACATAGGGATGCAAGG - Intergenic
941175099 2:162187446-162187468 ACCCAACAACTATAGAGACATGG + Intronic
941475349 2:165945181-165945203 ATTGAACAGCTCTAGATACAAGG - Intronic
942808598 2:179967850-179967872 ATCTAACAACTATAGTTAGTTGG - Intronic
943214636 2:185014478-185014500 ATCTGACACATTTAGGTACATGG + Intergenic
1169234350 20:3917633-3917655 ATTTAACAACTATACACACAGGG - Intronic
1170039174 20:12022340-12022362 ATCTAACACCTACAGATGGGAGG - Intergenic
1177843755 21:26264201-26264223 ATGTAGCTCCTATAGATTCATGG + Intergenic
950551587 3:13669398-13669420 ATCAGACACCTATACATAGAGGG - Intergenic
951258676 3:20481602-20481624 ATTTAACACCTACAGATGGATGG - Intergenic
952323537 3:32300094-32300116 ATCGAAGACCCAAAGATACAGGG + Intronic
953024521 3:39137180-39137202 GTCTAACACCTGCAGCTACATGG + Exonic
953361073 3:42297412-42297434 AACCAAAATCTATAGATACATGG + Intergenic
953727121 3:45409414-45409436 ATCAAATACCTCTAGATACATGG - Intronic
959240117 3:103780880-103780902 TCATAACACCTATAAATACAAGG + Intergenic
959251723 3:103956721-103956743 AATTAAGACCTAAAGATACAGGG + Intergenic
963219097 3:142787051-142787073 ATATTACACGTATATATACATGG + Intronic
963576520 3:147067216-147067238 ATCTGACATGTTTAGATACATGG + Intergenic
965006224 3:163028730-163028752 ATTTAACAGCTACAGACACATGG - Intergenic
966078590 3:175970386-175970408 ATATAACATTTATAGTTACAGGG - Intergenic
966243266 3:177777978-177778000 TTCTAGCACCTAAAGATATAGGG + Intergenic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
966897325 3:184455426-184455448 ATCTTACAGATATAGATATAGGG + Intronic
967082873 3:186066440-186066462 TTCTCTCACCTATAGATAGAAGG + Intronic
968022410 3:195405118-195405140 GTCTAACTCCTACAAATACAAGG + Intronic
970978808 4:22073290-22073312 ATCTAAGAGTTATAAATACATGG - Intergenic
972811554 4:42593366-42593388 AACAAAAACCTATAGGTACATGG + Intronic
972907108 4:43763953-43763975 ATCTAGCAACTATAAATAGATGG + Intergenic
974305477 4:60132967-60132989 ATGTAAGACCTACAGACACAGGG - Intergenic
974374119 4:61054681-61054703 CTCTCACACTTAAAGATACAAGG - Intergenic
979149112 4:117285697-117285719 ATCTATAATCTATAGAAACAAGG + Intergenic
979383010 4:120030805-120030827 AGCTAACTCCTATAAACACAGGG + Intergenic
979402249 4:120262783-120262805 ATATAACATGTATGGATACAGGG + Intergenic
979805698 4:124968020-124968042 ATCTGATGCATATAGATACACGG + Intergenic
980239599 4:130156471-130156493 ATTTGTCACCTTTAGATACAAGG + Intergenic
980913524 4:139014489-139014511 ATCTAACACCTGTGGATAGAGGG - Intergenic
982580327 4:157169615-157169637 ATTCAGAACCTATAGATACAAGG + Intronic
983882404 4:172948241-172948263 ATGTAACACTTATAGCTAGAGGG + Intronic
985072201 4:186177505-186177527 ATCTAAAATATATTGATACAGGG - Intergenic
987591248 5:19930024-19930046 AGCTAACACCCATTGATAAAAGG + Intronic
987599609 5:20050096-20050118 ATCTAATACTTATAGATATGAGG + Intronic
988355345 5:30166628-30166650 ATATCACAGCTATATATACATGG - Intergenic
991019853 5:61969019-61969041 GTAGAAGACCTATAGATACAAGG - Intergenic
992377764 5:76205974-76205996 ATTTAAGACCTACTGATACATGG + Intronic
995420122 5:111955402-111955424 ATCTAACACCTATAGATACAAGG - Intronic
1003672930 6:8176545-8176567 ATCAAGTGCCTATAGATACATGG + Intergenic
1009348803 6:62649059-62649081 ATTTAACATATTTAGATACATGG - Intergenic
1011125069 6:83998474-83998496 ATTTGAGACCTATAGATATAGGG - Intergenic
1012745726 6:103085603-103085625 AGCAAAAACCTATAGATACCTGG - Intergenic
1016116018 6:140286764-140286786 ATCTAACACTTATGGATAAAAGG + Intergenic
1024501707 7:50116590-50116612 ATCTAAAACCTAAATAGACAGGG + Intronic
1028057801 7:86269691-86269713 ATTGAACACCTAGAAATACAGGG + Intergenic
1030363876 7:108624604-108624626 ATACAACACATATAAATACACGG + Intergenic
1030743191 7:113134349-113134371 ATCTACCACCTAAAGATCCAGGG + Intergenic
1032967296 7:137113852-137113874 ATCTTACATCTCTAGATATATGG - Intergenic
1033111356 7:138580672-138580694 AGTTAACACCTATAGATAAAAGG + Exonic
1035544844 8:472426-472448 ATCTAACAGCTATGTATAAAAGG - Intergenic
1035609924 8:954859-954881 AACTAACACCTATACATCTAAGG - Intergenic
1037353203 8:17986812-17986834 CTCTAGCACCTAGAGATACATGG + Intronic
1039791639 8:40880782-40880804 ATATAACAGCTAAAAATACATGG - Intronic
1044064489 8:87682768-87682790 AACTAATACCTATAGACAAATGG - Intergenic
1044846961 8:96391530-96391552 AATTAACACGTATAAATACAGGG - Intergenic
1046410990 8:113842818-113842840 ATCTCAGACCTATAGCTGCAAGG + Intergenic
1048751217 8:137678566-137678588 ATCTAAAGCCTATAGCTATAAGG + Intergenic
1051283724 9:15472304-15472326 ATATAATACATATAGATAGAGGG - Intronic
1053327733 9:37171229-37171251 TTCTAACAACTACACATACAAGG - Intronic
1059516579 9:114901370-114901392 AGCCAACACCTAAAGACACAAGG - Intronic
1186998721 X:15152391-15152413 TTCTTACACCTATAGAATCATGG + Intergenic
1188923066 X:36003041-36003063 ATCTTACACCTTTAAATATAAGG + Intergenic
1192094950 X:68200845-68200867 ATCTAACATCTAGAAATAAAAGG + Intronic
1197616121 X:128693596-128693618 ATTTCACACCTATAGAACCAAGG + Intergenic
1199536966 X:148913528-148913550 ATTTAACACCTAAAGAGAAAAGG - Intronic
1202356439 Y:24055475-24055497 AACTATCACCTTTAAATACAGGG + Intergenic
1202514339 Y:25614634-25614656 AACTATCACCTTTAAATACAGGG - Intergenic