ID: 995420503

View in Genome Browser
Species Human (GRCh38)
Location 5:111961659-111961681
Sequence CATTATATGCAGGAACTATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995420503_995420507 6 Left 995420503 5:111961659-111961681 CCCTATAGTTCCTGCATATAATG 0: 1
1: 0
2: 0
3: 9
4: 171
Right 995420507 5:111961688-111961710 TGTTCTGAATCCTACACTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995420503 Original CRISPR CATTATATGCAGGAACTATA GGG (reversed) Intronic
903422013 1:23224935-23224957 CAGTAGATGCAGGAACCATGGGG - Intergenic
903567692 1:24280960-24280982 AATGATATGCAGGAACAACATGG - Intergenic
906415241 1:45616778-45616800 TCTTATATGCACCAACTATAGGG - Intronic
907797367 1:57731034-57731056 CATTATGCACAGGAACTAAAAGG + Intronic
908728421 1:67200984-67201006 CATGCTCTGCAGGAACTTTAGGG - Intronic
908927052 1:69268281-69268303 CAGGAGATTCAGGAACTATATGG + Intergenic
910565631 1:88639668-88639690 CATAATATGCAGGCACTACCTGG - Intergenic
912086983 1:106019966-106019988 CAATATATGCAGAAAATATTTGG + Intergenic
914695669 1:150076904-150076926 CTTTATTTGCAGGAATTTTATGG + Exonic
918830580 1:189392100-189392122 CATAATATCCAGAATCTATAGGG + Intergenic
919674200 1:200365526-200365548 CACTATAAACAGGAACTAGAAGG - Intergenic
919720668 1:200830736-200830758 AATTACTTGCAGGTACTATATGG - Intronic
924791991 1:247259907-247259929 CATAATATCCAGAATCTATAAGG + Intergenic
1063331397 10:5163304-5163326 CATTTTATCCAGTAAGTATAAGG - Intergenic
1063594986 10:7426502-7426524 GTTTATATGTAGGAACTAAAGGG - Intergenic
1063984651 10:11489687-11489709 CATCATAAGCAGGGACTATGGGG - Intronic
1064093292 10:12403629-12403651 CATTCTCTGCAGGAATTCTATGG - Intronic
1064470550 10:15631050-15631072 CATAATATCCAGAATCTATAAGG - Intronic
1065373976 10:25017525-25017547 CTTTTTATACAGGAACTAAAAGG - Intronic
1067058465 10:43065599-43065621 CATCAGATGCAGGACTTATAAGG - Intergenic
1068651457 10:59527535-59527557 CATTATATGCAGAACCAATGTGG - Intergenic
1071061262 10:81572385-81572407 CATAATATCCAGAATCTATAAGG + Intergenic
1071350339 10:84734317-84734339 CATTATATTCTGGAAGTTTAAGG + Intergenic
1076246834 10:128953594-128953616 CCTTATGTGAAGGAACTATTAGG + Intergenic
1080998849 11:37641853-37641875 AAATATATGAAGGAACTAAATGG - Intergenic
1084812705 11:71624456-71624478 CATTGTATGAAGGAACTGCAGGG - Intergenic
1085390651 11:76180466-76180488 CATGAAATGCAGGAACTCTGCGG - Intergenic
1088044335 11:105429257-105429279 CATTATATGCATGGAGTTTATGG - Intergenic
1093102407 12:15043395-15043417 CATTATATGAAGAAAAAATAAGG - Intergenic
1093208062 12:16274750-16274772 TATTTCATGCAGGAACTATTAGG + Intronic
1093574424 12:20710401-20710423 CATTTTATTCAGGCACTATTTGG - Intronic
1093787900 12:23214040-23214062 CCTGATATCCAGGATCTATAAGG - Intergenic
1094097380 12:26722541-26722563 TTTTATATGCAGTAGCTATAGGG + Exonic
1094759383 12:33513071-33513093 CCTAATATGCAGCATCTATAAGG - Intergenic
1095186405 12:39205908-39205930 CATAATATCCAGAATCTATAAGG + Intergenic
1096310851 12:50519159-50519181 CATGCTTTGCAGGAACTAAAGGG + Intronic
1098768430 12:74520155-74520177 CAATATTTTCAGGAACTTTAGGG - Intergenic
1099271528 12:80516727-80516749 TATTATATGCAGTAACCATGAGG - Intronic
1099445062 12:82742395-82742417 CATTATATGCCACCACTATATGG + Intronic
1101961865 12:109256688-109256710 CATTATAAGGAGGAACTTTCAGG - Intronic
1109430304 13:62224152-62224174 AATGATATTCAGGAACTAAAGGG - Intergenic
1109443705 13:62406514-62406536 CATTCTGTGCAGTAACTATCTGG + Intergenic
1109856835 13:68141333-68141355 CATTATATGCAGAAATGACATGG + Intergenic
1110430202 13:75414524-75414546 TATTATATGGAGGAAGAATATGG + Intronic
1113227581 13:108176218-108176240 CTTTATAAGAAGGGACTATAGGG - Intergenic
1120422637 14:84307689-84307711 CCTAATATCCAGGATCTATAAGG + Intergenic
1121374686 14:93397572-93397594 GATTACAGGCAGGAACCATAGGG - Intronic
1121554676 14:94827419-94827441 ACTTATAGGCAGTAACTATAAGG + Intergenic
1121932784 14:97988304-97988326 CAATAAAGGCAGGAACTACAGGG - Intergenic
1123674828 15:22700282-22700304 GACTATATGCAGACACTATATGG - Intergenic
1124326842 15:28773262-28773284 GACTATATGCAGACACTATATGG - Intergenic
1126894034 15:53238644-53238666 AATTAAATTCAGGAACTATGGGG - Intergenic
1128059943 15:64728944-64728966 CACTCTGTGCAGTAACTATAGGG - Intergenic
1137969438 16:52969478-52969500 TCTAATATCCAGGAACTATATGG - Intergenic
1142921426 17:3190528-3190550 CATTAGATGCCGGATCAATAGGG - Intergenic
1143734771 17:8903356-8903378 CATTTTTTGAAGGTACTATAGGG - Intronic
1145854142 17:28135784-28135806 CAATATGTGCCTGAACTATAAGG - Intronic
1155560332 18:27069291-27069313 AATTATATTAAGGAACTATAGGG - Intronic
1157572127 18:48720089-48720111 CAGTATTTGCAGCAACTTTATGG + Intronic
1157980834 18:52378419-52378441 CTCTACATGCAGGAACTACAAGG + Intronic
1158145983 18:54312830-54312852 CCTAATATCCAGGATCTATAAGG - Intronic
1158218009 18:55120529-55120551 CATAATATAAAGGAACAATATGG + Intergenic
1158762588 18:60408069-60408091 CATAATATCCAGAATCTATAAGG + Intergenic
1162317509 19:9948671-9948693 CATTCTATGCATGAACTCTTAGG - Intergenic
1164407189 19:27960915-27960937 AGTTATATGCAGGACCAATAGGG - Intergenic
1165919397 19:39284876-39284898 CATTATTTGCAATAACTAAAAGG + Intergenic
1168576220 19:57513234-57513256 CATTATATGCAGTCACTTAAAGG + Intronic
925378272 2:3404544-3404566 CATTATATGCATGAACTGGGAGG + Intronic
926263785 2:11294440-11294462 AATTATATGGTGGAATTATATGG + Intronic
927078642 2:19605340-19605362 TATAATATCCAGGATCTATAAGG - Intergenic
928934818 2:36664758-36664780 GTATATATCCAGGAACTATAGGG - Intergenic
930215386 2:48691156-48691178 AATAATATGTAGGAACCATAAGG - Intronic
930454679 2:51591795-51591817 CATTATATGCCAGAACTTTAAGG - Intergenic
932480306 2:72035213-72035235 CATTATATGCATGTATTCTATGG - Intergenic
935453269 2:103235564-103235586 CAGTATTTGCAGGAAATAAAGGG + Intergenic
935816263 2:106848843-106848865 AATTATTTGCAGGAACAAAAAGG - Intronic
938790130 2:134669149-134669171 CAGGATATGCTGGCACTATAAGG + Intronic
939673054 2:145037540-145037562 CAGTATATGAATGAATTATAAGG - Intergenic
941704792 2:168646417-168646439 TCTAATATGCAGGATCTATAAGG - Intronic
943227831 2:185204024-185204046 CATTTTATGTAGGAATAATATGG - Intergenic
943475203 2:188345878-188345900 CAGTATATGCAAGAAATATTAGG - Intronic
947049302 2:226024158-226024180 CATGTTATTCAGGAACTAAAAGG + Intergenic
949068040 2:242005530-242005552 TATTATATACAGGCATTATATGG - Intergenic
949068045 2:242005608-242005630 TATTATATACAGGCATTATAGGG - Intergenic
1172374649 20:34427732-34427754 CATTTTATGCGGGAACTTTCAGG - Intronic
1173214483 20:41067807-41067829 CATTATGTGCAGAAACAAAATGG + Intronic
1176894607 21:14361725-14361747 CATTATATGCAGTAATTCCATGG - Intergenic
1177071528 21:16514738-16514760 CCTGATATCCAGGATCTATATGG - Intergenic
1177162990 21:17568947-17568969 CTTTATATCCATGATCTATATGG - Exonic
1177606711 21:23388526-23388548 CATTATATCAAGAAAATATAAGG + Intergenic
1177692132 21:24524500-24524522 CTTTAAATGCGGGAACTTTATGG - Intergenic
1178048645 21:28724595-28724617 TATTATAATCAGGAACTATAAGG - Intergenic
1185209131 22:49557760-49557782 CATTACAGCCAGGAACTATGGGG - Intronic
1185209139 22:49557830-49557852 CATTACAGCCAGGAACTATGGGG - Intronic
1185209147 22:49557900-49557922 CATTACAGCCAGGAACTATGGGG - Intronic
1185209161 22:49558032-49558054 CATTACAGCCAGGAACTATGGGG - Intronic
1185209169 22:49558102-49558124 CATTACAGCCAGGAACTATGGGG - Intronic
1185209177 22:49558172-49558194 CATTACAGCCAGGAACTATGGGG - Intronic
1185209185 22:49558242-49558264 CATTACAGCCAGGAACTATGGGG - Intronic
1185209199 22:49558374-49558396 CATTACAGCCAGGAACTATGGGG - Intronic
949650534 3:6153754-6153776 CCTTATCTGCAGAAACTATAAGG + Intergenic
949776710 3:7641275-7641297 AATTATCTGCTGGAACTAAAAGG + Intronic
950052083 3:9999799-9999821 CATTTTATACATGATCTATAAGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
957477634 3:80747338-80747360 GATTATATGCAAGTTCTATAAGG + Intergenic
959173045 3:102867342-102867364 CATTATCAGCAGGAACAATGTGG + Intergenic
960239501 3:115323900-115323922 CATCATGTGCAGGAAGTATATGG - Intergenic
964710457 3:159666164-159666186 AACTATATGCAGGAGCTCTAAGG - Intronic
967612323 3:191521898-191521920 GAGAATATGCAGAAACTATATGG + Intergenic
970761041 4:19487058-19487080 CATTATAAGCAGGAACGGCAAGG + Intergenic
971624288 4:28898507-28898529 CCTAATATCCAGGATCTATATGG + Intergenic
971727658 4:30334462-30334484 CATTATGTGCAGTATTTATAAGG - Intergenic
971820752 4:31550968-31550990 CTTTAAATGCATGAATTATATGG + Intergenic
972140574 4:35954202-35954224 CCTAATATACAGGATCTATAAGG - Intronic
972145865 4:36024165-36024187 CATTATCTCTAGCAACTATAGGG + Intronic
975083869 4:70313124-70313146 CATTATGTGAAAGAAGTATATGG + Intergenic
975973789 4:80072836-80072858 CATTGTCTGCAGGAACTCTCCGG - Intronic
976936021 4:90634258-90634280 CAATATTTGCATCAACTATATGG - Intronic
977000112 4:91487629-91487651 TATTATATTAAGCAACTATATGG - Intronic
980640514 4:135571653-135571675 CATTACATGTAGGAAATATCTGG - Intergenic
981998293 4:150998987-150999009 CATTATCTGCTGGAAGTCTAAGG - Intronic
982336263 4:154242391-154242413 CATTATAAACAGATACTATAAGG + Intronic
982669981 4:158308775-158308797 CCTAATATCCAGAAACTATAGGG - Intergenic
983781260 4:171673407-171673429 CATTATTTGCAGGAATAATTGGG + Intergenic
983881120 4:172934393-172934415 CTTTTTATGCAGAAACTATAAGG + Intronic
984064515 4:175031756-175031778 CTTTATATGCAAAAACTATAAGG - Intergenic
984240486 4:177213404-177213426 CAATATATTCATGAAATATAAGG + Intergenic
985288334 4:188360562-188360584 AATTATATGCCAGAAATATATGG + Intergenic
987010443 5:13757659-13757681 CTTAATATCCAGGATCTATAAGG + Intronic
987630645 5:20467098-20467120 TATTTGATGCAGTAACTATATGG + Intronic
987915499 5:24207663-24207685 CATTATTGGCATGAACTATCTGG + Intergenic
988705583 5:33723250-33723272 GTTTATATGCAGCAAATATAAGG - Intronic
989439376 5:41452396-41452418 CTTTATAAGCAGAGACTATAAGG + Intronic
994588540 5:101743386-101743408 CATAATATCCAGAATCTATAGGG - Intergenic
994873633 5:105385277-105385299 TATTATATGCAGCAAGTATTAGG - Intergenic
995420503 5:111961659-111961681 CATTATATGCAGGAACTATAGGG - Intronic
995464004 5:112432117-112432139 CACAATATGCAGGAATTATGGGG - Intergenic
999357494 5:150949715-150949737 CACTATATGAGGGAACTACATGG - Intergenic
1004331596 6:14726932-14726954 CATTATTTGCAGGAGCCAAAAGG + Intergenic
1007256360 6:40532004-40532026 CCATATATGCAGGAACTGTGCGG - Intronic
1009781587 6:68278551-68278573 CCTAATATCCAGAAACTATAAGG - Intergenic
1010189300 6:73178459-73178481 CTTTATATGCAGGATCTAGTAGG - Intronic
1011183700 6:84650681-84650703 AATTTTATGCAGGACTTATAGGG + Intergenic
1011736560 6:90316341-90316363 CATTATATTCAAAAACTAGAAGG + Intergenic
1015090392 6:129349413-129349435 AATGATATGTAGGGACTATATGG + Intronic
1018237918 6:161743870-161743892 AATTATATTCAGGGACCATAGGG - Intronic
1020506398 7:8994263-8994285 CATTATATGCAAAAAGTATAGGG - Intergenic
1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG + Intronic
1024708666 7:51990106-51990128 TCTAATATTCAGGAACTATAAGG - Intergenic
1024922297 7:54572064-54572086 AATTATATTCAAGAACTTTAAGG - Intergenic
1025762700 7:64409493-64409515 GATTAAATGCAGGACTTATAAGG - Intergenic
1030442824 7:109609920-109609942 CAATATATGCAGAAACTCAAAGG + Intergenic
1030815229 7:114027513-114027535 CATTGTATCTAGGAACTATCTGG - Intronic
1035126758 7:156613470-156613492 CAGTCTCTGCAGGAACTATGTGG + Intergenic
1037017353 8:13925169-13925191 CATTTTATTCAGGAACCAAAAGG + Intergenic
1038667490 8:29552480-29552502 CTAAATATGCAGGAACTACAAGG - Intergenic
1039084193 8:33763582-33763604 CATTTTATTTAGGAACTAAAAGG - Intergenic
1042297785 8:67241635-67241657 GATAATATGCAGGAACAAGAGGG + Intronic
1042892076 8:73623201-73623223 CATTAAATGAAGTAACTTTAGGG - Intronic
1045159151 8:99517587-99517609 CATTATGTGCAGTTACTATCAGG + Intronic
1045598147 8:103681115-103681137 AACTAGATGCAGCAACTATAGGG + Intronic
1045892908 8:107178834-107178856 CTTTAAATGGATGAACTATATGG + Intergenic
1050804191 9:9653018-9653040 CATTATTTGAAGGAAAAATAGGG - Intronic
1052101461 9:24451310-24451332 CATTATAAGGAAGAACTTTAAGG + Intergenic
1052105064 9:24504274-24504296 CATCATATGAAGGTACTATATGG - Intergenic
1052285481 9:26779961-26779983 CCTAATATGCAGCATCTATAAGG + Intergenic
1053338209 9:37297619-37297641 CCTTATAAGAAGGAGCTATATGG + Intronic
1056162508 9:83910874-83910896 CATTATTTACAGGAGCTACAAGG + Intronic
1056357839 9:85820653-85820675 CATTATTTACAGGAGCTACAAGG - Intergenic
1057923900 9:99125481-99125503 TATTATATGCAAGTGCTATATGG - Intronic
1059993256 9:119885147-119885169 CATAATATGCAGGCATAATATGG - Intergenic
1187491593 X:19757264-19757286 CATTGTATTCAGGAACCAAAAGG - Intronic
1189311204 X:40019139-40019161 AATTTTATGCTGGAACCATAAGG + Intergenic
1190798025 X:53761778-53761800 CATGATAAGCAGGAACTAGCTGG + Intergenic
1192025046 X:67441180-67441202 CTTAATATCCAGGATCTATAAGG - Intergenic
1192028247 X:67479134-67479156 ACTTATAGGCAGGAGCTATATGG - Intergenic
1192133630 X:68576234-68576256 AATTGTATGCAGGAAATATTAGG + Intergenic
1193811123 X:86053080-86053102 CATTATATGCAGCATCCATCTGG + Intergenic
1193899740 X:87162575-87162597 CTTTTTTTGCAGGAGCTATAAGG + Intergenic
1196581827 X:117389442-117389464 CATTCAATACAAGAACTATAAGG - Intergenic
1197473240 X:126889385-126889407 CATTATATACAGGTAATAAATGG - Intergenic