ID: 995429030 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:112054195-112054217 |
| Sequence | GTGTTATGGACAATCAACTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 995429028_995429030 | -9 | Left | 995429028 | 5:112054181-112054203 | CCAAAATGCTGATAGTGTTATGG | No data | ||
| Right | 995429030 | 5:112054195-112054217 | GTGTTATGGACAATCAACTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 995429030 | Original CRISPR | GTGTTATGGACAATCAACTG AGG | Intergenic | ||