ID: 995429030

View in Genome Browser
Species Human (GRCh38)
Location 5:112054195-112054217
Sequence GTGTTATGGACAATCAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995429028_995429030 -9 Left 995429028 5:112054181-112054203 CCAAAATGCTGATAGTGTTATGG No data
Right 995429030 5:112054195-112054217 GTGTTATGGACAATCAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995429030 Original CRISPR GTGTTATGGACAATCAACTG AGG Intergenic