ID: 995430794

View in Genome Browser
Species Human (GRCh38)
Location 5:112074144-112074166
Sequence TCAAAGGCCTGGAGAGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995430788_995430794 7 Left 995430788 5:112074114-112074136 CCTCAAAGGAATTTTTCCAAAAG No data
Right 995430794 5:112074144-112074166 TCAAAGGCCTGGAGAGACAGAGG No data
995430792_995430794 -9 Left 995430792 5:112074130-112074152 CCAAAAGGGCTGTCTCAAAGGCC No data
Right 995430794 5:112074144-112074166 TCAAAGGCCTGGAGAGACAGAGG No data
995430785_995430794 30 Left 995430785 5:112074091-112074113 CCTGATGGAGGATCTCTCACCTA No data
Right 995430794 5:112074144-112074166 TCAAAGGCCTGGAGAGACAGAGG No data
995430787_995430794 11 Left 995430787 5:112074110-112074132 CCTACCTCAAAGGAATTTTTCCA No data
Right 995430794 5:112074144-112074166 TCAAAGGCCTGGAGAGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995430794 Original CRISPR TCAAAGGCCTGGAGAGACAG AGG Intergenic
No off target data available for this crispr