ID: 995433513

View in Genome Browser
Species Human (GRCh38)
Location 5:112109373-112109395
Sequence TTGCCTCAGCTGGAGATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995433510_995433513 -2 Left 995433510 5:112109352-112109374 CCTGTGACCATCTCTAGAGCATT No data
Right 995433513 5:112109373-112109395 TTGCCTCAGCTGGAGATGCCTGG No data
995433511_995433513 -9 Left 995433511 5:112109359-112109381 CCATCTCTAGAGCATTGCCTCAG No data
Right 995433513 5:112109373-112109395 TTGCCTCAGCTGGAGATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995433513 Original CRISPR TTGCCTCAGCTGGAGATGCC TGG Intergenic
No off target data available for this crispr